\
| Variant ID: vg0727529174 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27529174 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, G: 0.07, others allele: 0.00, population size: 41. )
TGGTCTTTAGTTCCTAATTTTTTTTCCAAAAACATCACATCAAATCTTTGGATATATGCATGGACAGTAAAGAGATCTCAACATTAAATATAGATAAAAA[T/G]
AAAAAACTACTTGCACAATTTGCAATGGAAATCGCGGGATGAATCTTTTGAGCCTAATTGGTCCATGACTAGCTATAAGTGCTACAGTAACCCACATTTG
CAAATGTGGGTTACTGTAGCACTTATAGCTAGTCATGGACCAATTAGGCTCAAAAGATTCATCCCGCGATTTCCATTGCAAATTGTGCAAGTAGTTTTTT[A/C]
TTTTTATCTATATTTAATGTTGAGATCTCTTTACTGTCCATGCATATATCCAAAGATTTGATGTGATGTTTTTGGAAAAAAAATTAGGAACTAAAGACCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.20% | 19.90% | 0.99% | 47.84% | NA |
| All Indica | 2759 | 50.10% | 5.90% | 1.27% | 42.73% | NA |
| All Japonica | 1512 | 1.50% | 42.90% | 0.53% | 55.09% | NA |
| Aus | 269 | 16.70% | 1.10% | 0.74% | 81.41% | NA |
| Indica I | 595 | 40.30% | 3.50% | 0.67% | 55.46% | NA |
| Indica II | 465 | 83.00% | 2.60% | 2.58% | 11.83% | NA |
| Indica III | 913 | 42.10% | 7.70% | 0.99% | 49.29% | NA |
| Indica Intermediate | 786 | 47.30% | 7.60% | 1.27% | 43.77% | NA |
| Temperate Japonica | 767 | 1.60% | 66.20% | 0.26% | 31.94% | NA |
| Tropical Japonica | 504 | 1.00% | 13.10% | 0.99% | 84.92% | NA |
| Japonica Intermediate | 241 | 2.10% | 31.10% | 0.41% | 66.39% | NA |
| VI/Aromatic | 96 | 4.20% | 89.60% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 25.60% | 45.60% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727529174 | T -> DEL | N | N | silent_mutation | Average:28.575; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0727529174 | T -> G | LOC_Os07g46120.1 | downstream_gene_variant ; 1758.0bp to feature; MODIFIER | silent_mutation | Average:28.575; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0727529174 | T -> G | LOC_Os07g46130.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.575; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727529174 | NA | 5.03E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 6.96E-07 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 3.45E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 1.35E-06 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 3.00E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 3.42E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 6.34E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 3.13E-06 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 6.51E-06 | mr1888 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 2.91E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 8.64E-06 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 7.71E-06 | mr1227_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | 6.51E-06 | NA | mr1362_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 2.44E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 6.76E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727529174 | NA | 7.59E-06 | mr1960_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |