\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727516818:

Variant ID: vg0727516818 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27516818
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.44, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CAATGGTAGGGAGGAATCAAAGTCGTGGAACCGGTAGAGCAGAGGAGTGTGGAGACAACCGGCACACGGTGCAAGGAGGCGCAGATCAAAGGCTGAGAGC[G/A]
TGGTGGGTAGGTCAGCGATAGCTTTAGGGCGGTGGAGAGAAGGAGCTCTCCACTGTTGTCGGCGACCGGCGCCTCCTCTGCATGTCTCAAGCTTGGATCA

Reverse complement sequence

TGATCCAAGCTTGAGACATGCAGAGGAGGCGCCGGTCGCCGACAACAGTGGAGAGCTCCTTCTCTCCACCGCCCTAAAGCTATCGCTGACCTACCCACCA[C/T]
GCTCTCAGCCTTTGATCTGCGCCTCCTTGCACCGTGTGCCGGTTGTCTCCACACTCCTCTGCTCTACCGGTTCCACGACTTTGATTCCTCCCTACCATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.60% 17.40% 2.52% 42.45% NA
All Indica  2759 54.70% 5.40% 2.57% 37.30% NA
All Japonica  1512 2.10% 42.80% 1.59% 53.51% NA
Aus  269 40.50% 0.40% 7.43% 51.67% NA
Indica I  595 51.60% 3.40% 3.53% 41.51% NA
Indica II  465 84.70% 2.40% 3.87% 9.03% NA
Indica III  913 42.90% 7.00% 0.88% 49.18% NA
Indica Intermediate  786 53.10% 6.90% 3.05% 37.02% NA
Temperate Japonica  767 1.80% 66.50% 1.04% 30.64% NA
Tropical Japonica  504 1.60% 13.10% 2.38% 82.94% NA
Japonica Intermediate  241 4.10% 29.50% 1.66% 64.73% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 40.00% 30.00% 3.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727516818 G -> DEL N N silent_mutation Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0727516818 G -> A LOC_Os07g46100.1 upstream_gene_variant ; 407.0bp to feature; MODIFIER silent_mutation Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0727516818 G -> A LOC_Os07g46110.1 upstream_gene_variant ; 1244.0bp to feature; MODIFIER silent_mutation Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0727516818 G -> A LOC_Os07g46090.1 downstream_gene_variant ; 2509.0bp to feature; MODIFIER silent_mutation Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N
vg0727516818 G -> A LOC_Os07g46100-LOC_Os07g46110 intergenic_region ; MODIFIER silent_mutation Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727516818 NA 3.08E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818 NA 5.18E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818 NA 2.08E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818 NA 4.39E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818 NA 3.47E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818 7.84E-06 7.83E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818 NA 4.77E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818 NA 5.25E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818 2.32E-06 3.06E-08 mr1853_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251