Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0727516818:

Variant ID: vg0727516818 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27516818
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.44, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

CAATGGTAGGGAGGAATCAAAGTCGTGGAACCGGTAGAGCAGAGGAGTGTGGAGACAACCGGCACACGGTGCAAGGAGGCGCAGATCAAAGGCTGAGAGC[G/A]
TGGTGGGTAGGTCAGCGATAGCTTTAGGGCGGTGGAGAGAAGGAGCTCTCCACTGTTGTCGGCGACCGGCGCCTCCTCTGCATGTCTCAAGCTTGGATCA

Reverse complement sequence

TGATCCAAGCTTGAGACATGCAGAGGAGGCGCCGGTCGCCGACAACAGTGGAGAGCTCCTTCTCTCCACCGCCCTAAAGCTATCGCTGACCTACCCACCA[C/T]
GCTCTCAGCCTTTGATCTGCGCCTCCTTGCACCGTGTGCCGGTTGTCTCCACACTCCTCTGCTCTACCGGTTCCACGACTTTGATTCCTCCCTACCATTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.60%	17.40%	2.52%	42.45%	NA
All Indica	2759	54.70%	5.40%	2.57%	37.30%	NA
All Japonica	1512	2.10%	42.80%	1.59%	53.51%	NA
Aus	269	40.50%	0.40%	7.43%	51.67%	NA
Indica I	595	51.60%	3.40%	3.53%	41.51%	NA
Indica II	465	84.70%	2.40%	3.87%	9.03%	NA
Indica III	913	42.90%	7.00%	0.88%	49.18%	NA
Indica Intermediate	786	53.10%	6.90%	3.05%	37.02%	NA
Temperate Japonica	767	1.80%	66.50%	1.04%	30.64%	NA
Tropical Japonica	504	1.60%	13.10%	2.38%	82.94%	NA
Japonica Intermediate	241	4.10%	29.50%	1.66%	64.73%	NA
VI/Aromatic	96	93.80%	0.00%	1.04%	5.21%	NA
Intermediate	90	40.00%	30.00%	3.33%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727516818	G -> DEL	N	N	silent_mutation	Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N
vg0727516818	G -> A	LOC_Os07g46100.1	upstream_gene_variant ; 407.0bp to feature; MODIFIER	silent_mutation	Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N
vg0727516818	G -> A	LOC_Os07g46110.1	upstream_gene_variant ; 1244.0bp to feature; MODIFIER	silent_mutation	Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N
vg0727516818	G -> A	LOC_Os07g46090.1	downstream_gene_variant ; 2509.0bp to feature; MODIFIER	silent_mutation	Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N
vg0727516818	G -> A	LOC_Os07g46100-LOC_Os07g46110	intergenic_region ; MODIFIER	silent_mutation	Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727516818	NA	3.08E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818	NA	5.18E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818	NA	2.08E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818	NA	4.39E-07	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818	NA	3.47E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818	7.84E-06	7.83E-06	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818	NA	4.77E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818	NA	5.25E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727516818	2.32E-06	3.06E-08	mr1853_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251