\
| Variant ID: vg0727516818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27516818 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.44, others allele: 0.00, population size: 45. )
CAATGGTAGGGAGGAATCAAAGTCGTGGAACCGGTAGAGCAGAGGAGTGTGGAGACAACCGGCACACGGTGCAAGGAGGCGCAGATCAAAGGCTGAGAGC[G/A]
TGGTGGGTAGGTCAGCGATAGCTTTAGGGCGGTGGAGAGAAGGAGCTCTCCACTGTTGTCGGCGACCGGCGCCTCCTCTGCATGTCTCAAGCTTGGATCA
TGATCCAAGCTTGAGACATGCAGAGGAGGCGCCGGTCGCCGACAACAGTGGAGAGCTCCTTCTCTCCACCGCCCTAAAGCTATCGCTGACCTACCCACCA[C/T]
GCTCTCAGCCTTTGATCTGCGCCTCCTTGCACCGTGTGCCGGTTGTCTCCACACTCCTCTGCTCTACCGGTTCCACGACTTTGATTCCTCCCTACCATTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.60% | 17.40% | 2.52% | 42.45% | NA |
| All Indica | 2759 | 54.70% | 5.40% | 2.57% | 37.30% | NA |
| All Japonica | 1512 | 2.10% | 42.80% | 1.59% | 53.51% | NA |
| Aus | 269 | 40.50% | 0.40% | 7.43% | 51.67% | NA |
| Indica I | 595 | 51.60% | 3.40% | 3.53% | 41.51% | NA |
| Indica II | 465 | 84.70% | 2.40% | 3.87% | 9.03% | NA |
| Indica III | 913 | 42.90% | 7.00% | 0.88% | 49.18% | NA |
| Indica Intermediate | 786 | 53.10% | 6.90% | 3.05% | 37.02% | NA |
| Temperate Japonica | 767 | 1.80% | 66.50% | 1.04% | 30.64% | NA |
| Tropical Japonica | 504 | 1.60% | 13.10% | 2.38% | 82.94% | NA |
| Japonica Intermediate | 241 | 4.10% | 29.50% | 1.66% | 64.73% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 40.00% | 30.00% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727516818 | G -> DEL | N | N | silent_mutation | Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0727516818 | G -> A | LOC_Os07g46100.1 | upstream_gene_variant ; 407.0bp to feature; MODIFIER | silent_mutation | Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0727516818 | G -> A | LOC_Os07g46110.1 | upstream_gene_variant ; 1244.0bp to feature; MODIFIER | silent_mutation | Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0727516818 | G -> A | LOC_Os07g46090.1 | downstream_gene_variant ; 2509.0bp to feature; MODIFIER | silent_mutation | Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| vg0727516818 | G -> A | LOC_Os07g46100-LOC_Os07g46110 | intergenic_region ; MODIFIER | silent_mutation | Average:73.964; most accessible tissue: Zhenshan97 young leaf, score: 87.584 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727516818 | NA | 3.08E-06 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727516818 | NA | 5.18E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727516818 | NA | 2.08E-06 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727516818 | NA | 4.39E-07 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727516818 | NA | 3.47E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727516818 | 7.84E-06 | 7.83E-06 | mr1562_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727516818 | NA | 4.77E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727516818 | NA | 5.25E-07 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727516818 | 2.32E-06 | 3.06E-08 | mr1853_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |