\
| Variant ID: vg0727501372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27501372 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 108. )
ATTACAGAATCTACTTATAAACTGCGAGATGAATTTATTAAGCCTAATTAATCCATCATTAGCAAATATTTACTGTAGCTCCACATTGTCAAATCATGTA[G/A]
CAATTAAGCTTAAAAAGATTTGTCTCGCAAATTAGTCGCAATATGTGTAATTAGTTAATTTTTTTAGCTTATATTTTATACTTCATACAGGTGTTCAAAC
GTTTGAACACCTGTATGAAGTATAAAATATAAGCTAAAAAAATTAACTAATTACACATATTGCGACTAATTTGCGAGACAAATCTTTTTAAGCTTAATTG[C/T]
TACATGATTTGACAATGTGGAGCTACAGTAAATATTTGCTAATGATGGATTAATTAGGCTTAATAAATTCATCTCGCAGTTTATAAGTAGATTCTGTAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.40% | 12.30% | 2.71% | 6.64% | NA |
| All Indica | 2759 | 93.00% | 4.10% | 0.87% | 2.03% | NA |
| All Japonica | 1512 | 47.90% | 30.20% | 6.61% | 15.21% | NA |
| Aus | 269 | 90.70% | 0.40% | 0.00% | 8.92% | NA |
| Indica I | 595 | 96.60% | 1.70% | 0.34% | 1.34% | NA |
| Indica II | 465 | 98.10% | 1.30% | 0.22% | 0.43% | NA |
| Indica III | 913 | 97.60% | 0.70% | 0.44% | 1.31% | NA |
| Indica Intermediate | 786 | 81.80% | 11.70% | 2.16% | 4.33% | NA |
| Temperate Japonica | 767 | 67.50% | 20.90% | 3.91% | 7.69% | NA |
| Tropical Japonica | 504 | 24.60% | 41.10% | 9.92% | 24.40% | NA |
| Japonica Intermediate | 241 | 34.40% | 37.30% | 8.30% | 19.92% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 8.90% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727501372 | G -> DEL | N | N | silent_mutation | Average:48.469; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0727501372 | G -> A | LOC_Os07g46080.1 | upstream_gene_variant ; 465.0bp to feature; MODIFIER | silent_mutation | Average:48.469; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0727501372 | G -> A | LOC_Os07g46070.1 | downstream_gene_variant ; 3676.0bp to feature; MODIFIER | silent_mutation | Average:48.469; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| vg0727501372 | G -> A | LOC_Os07g46070-LOC_Os07g46080 | intergenic_region ; MODIFIER | silent_mutation | Average:48.469; most accessible tissue: Zhenshan97 panicle, score: 82.336 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727501372 | NA | 1.02E-08 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727501372 | NA | 2.20E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727501372 | 5.25E-06 | 5.25E-06 | mr1369_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727501372 | 3.95E-06 | 8.10E-07 | mr1528_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727501372 | NA | 4.62E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727501372 | 5.78E-06 | 5.78E-06 | mr1652_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727501372 | 7.51E-06 | 7.50E-06 | mr1697_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |