\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727476091:

Variant ID: vg0727476091 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27476091
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGAAATTAACTTCATCCCAAGTAGGTTCACAGTTGCCAAATGGACAGCGTTTTTCATATTGCTCGTAGTTGTGCTCATGGTAACAATCAGCAGGTTGC[G/A]
GTTCCCAATAGTCACCAAACTAGCAGATAGTGCTCTGTGCAGAAAGCTATTAGTTTGGGGTCAAACTATCCAGAATATGTGCATGCTTGCTGCGCTAGTG

Reverse complement sequence

CACTAGCGCAGCAAGCATGCACATATTCTGGATAGTTTGACCCCAAACTAATAGCTTTCTGCACAGAGCACTATCTGCTAGTTTGGTGACTATTGGGAAC[C/T]
GCAACCTGCTGATTGTTACCATGAGCACAACTACGAGCAATATGAAAAACGCTGTCCATTTGGCAACTGTGAACCTACTTGGGATGAAGTTAATTTCAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 12.50% 19.91% 17.41% NA
All Indica  2759 29.70% 16.60% 25.30% 28.38% NA
All Japonica  1512 98.00% 0.10% 1.52% 0.40% NA
Aus  269 3.70% 45.00% 43.49% 7.81% NA
Indica I  595 13.40% 52.60% 12.94% 21.01% NA
Indica II  465 14.80% 7.10% 29.03% 49.03% NA
Indica III  913 44.50% 1.10% 30.78% 23.66% NA
Indica Intermediate  786 33.60% 13.10% 26.08% 27.23% NA
Temperate Japonica  767 99.10% 0.00% 0.26% 0.65% NA
Tropical Japonica  504 96.60% 0.00% 3.37% 0.00% NA
Japonica Intermediate  241 97.50% 0.40% 1.66% 0.41% NA
VI/Aromatic  96 5.20% 4.20% 83.33% 7.29% NA
Intermediate  90 62.20% 5.60% 25.56% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727476091 G -> DEL N N silent_mutation Average:9.623; most accessible tissue: Callus, score: 31.832 N N N N
vg0727476091 G -> A LOC_Os07g46039.1 3_prime_UTR_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:9.623; most accessible tissue: Callus, score: 31.832 N N N N
vg0727476091 G -> A LOC_Os07g46039.2 3_prime_UTR_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:9.623; most accessible tissue: Callus, score: 31.832 N N N N
vg0727476091 G -> A LOC_Os07g46030.1 downstream_gene_variant ; 3742.0bp to feature; MODIFIER silent_mutation Average:9.623; most accessible tissue: Callus, score: 31.832 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727476091 NA 3.69E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 4.26E-07 mr1156_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 5.57E-09 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 5.50E-09 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 8.84E-06 3.00E-06 mr1499_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 4.68E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 1.58E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 1.24E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 1.72E-19 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 2.28E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 2.12E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 1.04E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727476091 NA 2.05E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251