\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727265567:

Variant ID: vg0727265567 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27265567
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CTAAAAAGCAGTCGGCTAGAGTGCCTCTTTAGGCGCCGTGTATGCTTTTGTCATGTGATGCGCGATTGTGCTATTATTTTGTTCTCAACTATATGTTTAG[C/T]
TTGTTAACTAATCACATAGTTGGGGGCTACACCTAATTAGGTGCATCTATTCGATGCACCATATTCTTTATCTTTTCGCCCTTTACAGTCTTCGTCTTCG

Reverse complement sequence

CGAAGACGAAGACTGTAAAGGGCGAAAAGATAAAGAATATGGTGCATCGAATAGATGCACCTAATTAGGTGTAGCCCCCAACTATGTGATTAGTTAACAA[G/A]
CTAAACATATAGTTGAGAACAAAATAATAGCACAATCGCGCATCACATGACAAAAGCATACACGGCGCCTAAAGAGGCACTCTAGCCGACTGCTTTTTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.60% 5.00% 54.78% 11.66% NA
All Indica  2759 18.20% 2.50% 77.75% 1.49% NA
All Japonica  1512 51.10% 6.30% 10.25% 32.41% NA
Aus  269 7.10% 2.60% 86.99% 3.35% NA
Indica I  595 22.50% 1.80% 72.10% 3.53% NA
Indica II  465 19.40% 3.20% 75.48% 1.94% NA
Indica III  913 6.20% 1.30% 92.44% 0.00% NA
Indica Intermediate  786 28.20% 4.10% 66.28% 1.40% NA
Temperate Japonica  767 61.90% 2.70% 11.21% 24.12% NA
Tropical Japonica  504 37.90% 13.30% 8.53% 40.28% NA
Japonica Intermediate  241 44.00% 2.90% 10.79% 42.32% NA
VI/Aromatic  96 16.70% 49.00% 32.29% 2.08% NA
Intermediate  90 46.70% 16.70% 26.67% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727265567 C -> DEL N N silent_mutation Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0727265567 C -> T LOC_Os07g45660.1 upstream_gene_variant ; 823.0bp to feature; MODIFIER silent_mutation Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0727265567 C -> T LOC_Os07g45650.1 downstream_gene_variant ; 4079.0bp to feature; MODIFIER silent_mutation Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0727265567 C -> T LOC_Os07g45670.1 downstream_gene_variant ; 2603.0bp to feature; MODIFIER silent_mutation Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0727265567 C -> T LOC_Os07g45660-LOC_Os07g45670 intergenic_region ; MODIFIER silent_mutation Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727265567 NA 1.85E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 NA 8.39E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 NA 1.55E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 NA 6.98E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 5.48E-06 1.57E-22 mr1336_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 NA 2.06E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 NA 1.90E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 NA 1.29E-17 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 NA 1.81E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567 NA 3.36E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251