\
| Variant ID: vg0727265567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27265567 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 88. )
CTAAAAAGCAGTCGGCTAGAGTGCCTCTTTAGGCGCCGTGTATGCTTTTGTCATGTGATGCGCGATTGTGCTATTATTTTGTTCTCAACTATATGTTTAG[C/T]
TTGTTAACTAATCACATAGTTGGGGGCTACACCTAATTAGGTGCATCTATTCGATGCACCATATTCTTTATCTTTTCGCCCTTTACAGTCTTCGTCTTCG
CGAAGACGAAGACTGTAAAGGGCGAAAAGATAAAGAATATGGTGCATCGAATAGATGCACCTAATTAGGTGTAGCCCCCAACTATGTGATTAGTTAACAA[G/A]
CTAAACATATAGTTGAGAACAAAATAATAGCACAATCGCGCATCACATGACAAAAGCATACACGGCGCCTAAAGAGGCACTCTAGCCGACTGCTTTTTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.60% | 5.00% | 54.78% | 11.66% | NA |
| All Indica | 2759 | 18.20% | 2.50% | 77.75% | 1.49% | NA |
| All Japonica | 1512 | 51.10% | 6.30% | 10.25% | 32.41% | NA |
| Aus | 269 | 7.10% | 2.60% | 86.99% | 3.35% | NA |
| Indica I | 595 | 22.50% | 1.80% | 72.10% | 3.53% | NA |
| Indica II | 465 | 19.40% | 3.20% | 75.48% | 1.94% | NA |
| Indica III | 913 | 6.20% | 1.30% | 92.44% | 0.00% | NA |
| Indica Intermediate | 786 | 28.20% | 4.10% | 66.28% | 1.40% | NA |
| Temperate Japonica | 767 | 61.90% | 2.70% | 11.21% | 24.12% | NA |
| Tropical Japonica | 504 | 37.90% | 13.30% | 8.53% | 40.28% | NA |
| Japonica Intermediate | 241 | 44.00% | 2.90% | 10.79% | 42.32% | NA |
| VI/Aromatic | 96 | 16.70% | 49.00% | 32.29% | 2.08% | NA |
| Intermediate | 90 | 46.70% | 16.70% | 26.67% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727265567 | C -> DEL | N | N | silent_mutation | Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0727265567 | C -> T | LOC_Os07g45660.1 | upstream_gene_variant ; 823.0bp to feature; MODIFIER | silent_mutation | Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0727265567 | C -> T | LOC_Os07g45650.1 | downstream_gene_variant ; 4079.0bp to feature; MODIFIER | silent_mutation | Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0727265567 | C -> T | LOC_Os07g45670.1 | downstream_gene_variant ; 2603.0bp to feature; MODIFIER | silent_mutation | Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0727265567 | C -> T | LOC_Os07g45660-LOC_Os07g45670 | intergenic_region ; MODIFIER | silent_mutation | Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727265567 | NA | 1.85E-10 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | NA | 8.39E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | NA | 1.55E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | NA | 6.98E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | 5.48E-06 | 1.57E-22 | mr1336_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | NA | 2.06E-08 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | NA | 1.90E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | NA | 1.29E-17 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | NA | 1.81E-06 | mr1652_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727265567 | NA | 3.36E-09 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |