Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727265567:

Variant ID: vg0727265567 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27265567
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, C: 0.02, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAAAAGCAGTCGGCTAGAGTGCCTCTTTAGGCGCCGTGTATGCTTTTGTCATGTGATGCGCGATTGTGCTATTATTTTGTTCTCAACTATATGTTTAG[C/T]
TTGTTAACTAATCACATAGTTGGGGGCTACACCTAATTAGGTGCATCTATTCGATGCACCATATTCTTTATCTTTTCGCCCTTTACAGTCTTCGTCTTCG

Reverse complement sequence

CGAAGACGAAGACTGTAAAGGGCGAAAAGATAAAGAATATGGTGCATCGAATAGATGCACCTAATTAGGTGTAGCCCCCAACTATGTGATTAGTTAACAA[G/A]
CTAAACATATAGTTGAGAACAAAATAATAGCACAATCGCGCATCACATGACAAAAGCATACACGGCGCCTAAAGAGGCACTCTAGCCGACTGCTTTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.60%	5.00%	54.78%	11.66%	NA
All Indica	2759	18.20%	2.50%	77.75%	1.49%	NA
All Japonica	1512	51.10%	6.30%	10.25%	32.41%	NA
Aus	269	7.10%	2.60%	86.99%	3.35%	NA
Indica I	595	22.50%	1.80%	72.10%	3.53%	NA
Indica II	465	19.40%	3.20%	75.48%	1.94%	NA
Indica III	913	6.20%	1.30%	92.44%	0.00%	NA
Indica Intermediate	786	28.20%	4.10%	66.28%	1.40%	NA
Temperate Japonica	767	61.90%	2.70%	11.21%	24.12%	NA
Tropical Japonica	504	37.90%	13.30%	8.53%	40.28%	NA
Japonica Intermediate	241	44.00%	2.90%	10.79%	42.32%	NA
VI/Aromatic	96	16.70%	49.00%	32.29%	2.08%	NA
Intermediate	90	46.70%	16.70%	26.67%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727265567	C -> DEL	N	N	silent_mutation	Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0727265567	C -> T	LOC_Os07g45660.1	upstream_gene_variant ; 823.0bp to feature; MODIFIER	silent_mutation	Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0727265567	C -> T	LOC_Os07g45650.1	downstream_gene_variant ; 4079.0bp to feature; MODIFIER	silent_mutation	Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0727265567	C -> T	LOC_Os07g45670.1	downstream_gene_variant ; 2603.0bp to feature; MODIFIER	silent_mutation	Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg0727265567	C -> T	LOC_Os07g45660-LOC_Os07g45670	intergenic_region ; MODIFIER	silent_mutation	Average:17.684; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727265567	NA	1.85E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	NA	8.39E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	NA	1.55E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	NA	6.98E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	5.48E-06	1.57E-22	mr1336_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	NA	2.06E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	NA	1.90E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	NA	1.29E-17	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	NA	1.81E-06	mr1652_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727265567	NA	3.36E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251