\
| Variant ID: vg0727263961 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27263961 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCGGAGGCGGATTGAATGCGTTGTATGGTACAACTGGCAGTTGATGTGAGTAGCTGACGACAATAGCGTTCGAGAATATCTTGTACATCCTCTCCTTCA[G/T]
GATCTTAAAATCCAAAGAATCTGGGTCTTCACGGTTTGGATCATGCTTGCCGTCAAACTCAAATGCTGTGCGGGATCTTTCTTTGATTGGAGCTAATCGG
CCGATTAGCTCCAATCAAAGAAAGATCCCGCACAGCATTTGAGTTTGACGGCAAGCATGATCCAAACCGTGAAGACCCAGATTCTTTGGATTTTAAGATC[C/A]
TGAAGGAGAGGATGTACAAGATATTCTCGAACGCTATTGTCGTCAGCTACTCACATCAACTGCCAGTTGTACCATACAACGCATTCAATCCGCCTCCGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.00% | 0.60% | 45.81% | 7.58% | NA |
| All Indica | 2759 | 23.50% | 0.20% | 65.64% | 10.69% | NA |
| All Japonica | 1512 | 93.80% | 0.00% | 3.70% | 2.51% | NA |
| Aus | 269 | 12.30% | 7.40% | 75.09% | 5.20% | NA |
| Indica I | 595 | 35.80% | 0.00% | 44.03% | 20.17% | NA |
| Indica II | 465 | 26.70% | 0.00% | 63.87% | 9.46% | NA |
| Indica III | 913 | 4.80% | 0.30% | 88.94% | 5.91% | NA |
| Indica Intermediate | 786 | 33.80% | 0.40% | 55.98% | 9.80% | NA |
| Temperate Japonica | 767 | 96.50% | 0.00% | 1.69% | 1.83% | NA |
| Tropical Japonica | 504 | 88.50% | 0.00% | 7.34% | 4.17% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 2.49% | 1.24% | NA |
| VI/Aromatic | 96 | 19.80% | 0.00% | 73.96% | 6.25% | NA |
| Intermediate | 90 | 65.60% | 1.10% | 27.78% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727263961 | G -> DEL | LOC_Os07g45660.1 | N | frameshift_variant | Average:9.878; most accessible tissue: Callus, score: 24.63 | N | N | N | N |
| vg0727263961 | G -> T | LOC_Os07g45660.1 | missense_variant ; p.Leu262Met; MODERATE | nonsynonymous_codon ; L262M | Average:9.878; most accessible tissue: Callus, score: 24.63 | benign |
0.341 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727263961 | NA | 2.97E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 3.07E-08 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | 3.10E-07 | NA | mr1301 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 2.73E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 2.69E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 3.51E-19 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 6.26E-08 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 5.07E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 2.58E-16 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 9.77E-21 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 2.21E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727263961 | NA | 4.35E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |