\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727217188:

Variant ID: vg0727217188 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27217188
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAAAAGGCAATTTTCCCGGTCGCGACAACCTTCCCGCCCATCGGGCAAGGTCACACCACTTTCCTAATCTAAGCAAGATTAAAATCTATGAGGCTAGT[A/C]
AAGTGTAGTACAAGTCCCGGTGCTCAATAACCGCGAGCACGACTATTCGAATAGATTTGATTTACTCACACTGCAATGGATGTACGCTTTTAATCCCGCA

Reverse complement sequence

TGCGGGATTAAAAGCGTACATCCATTGCAGTGTGAGTAAATCAAATCTATTCGAATAGTCGTGCTCGCGGTTATTGAGCACCGGGACTTGTACTACACTT[T/G]
ACTAGCCTCATAGATTTTAATCTTGCTTAGATTAGGAAAGTGGTGTGACCTTGCCCGATGGGCGGGAAGGTTGTCGCGACCGGGAAAATTGCCTTTTCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.50% 13.30% 19.61% 19.61% NA
All Indica  2759 46.20% 2.80% 24.61% 26.42% NA
All Japonica  1512 50.90% 35.20% 12.50% 1.39% NA
Aus  269 52.00% 0.40% 10.78% 36.80% NA
Indica I  595 60.70% 4.40% 22.35% 12.61% NA
Indica II  465 19.40% 3.70% 36.99% 40.00% NA
Indica III  913 52.00% 0.20% 19.93% 27.82% NA
Indica Intermediate  786 44.40% 3.90% 24.43% 27.23% NA
Temperate Japonica  767 27.20% 55.10% 16.82% 0.78% NA
Tropical Japonica  504 84.90% 5.60% 7.14% 2.38% NA
Japonica Intermediate  241 55.20% 33.60% 9.96% 1.24% NA
VI/Aromatic  96 20.80% 0.00% 16.67% 62.50% NA
Intermediate  90 44.40% 20.00% 15.56% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727217188 A -> DEL N N silent_mutation Average:35.345; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0727217188 A -> C LOC_Os07g45600.1 upstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:35.345; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0727217188 A -> C LOC_Os07g45590.1 downstream_gene_variant ; 4074.0bp to feature; MODIFIER silent_mutation Average:35.345; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0727217188 A -> C LOC_Os07g45610.1 intron_variant ; MODIFIER silent_mutation Average:35.345; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727217188 NA 7.47E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 6.93E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 1.51E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 1.16E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 5.18E-06 1.44E-08 mr1942 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 7.44E-09 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 1.89E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 4.90E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 3.76E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 1.09E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 5.55E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 1.71E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727217188 NA 2.81E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251