\
| Variant ID: vg0727217188 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27217188 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, others allele: 0.00, population size: 41. )
GGGAAAAGGCAATTTTCCCGGTCGCGACAACCTTCCCGCCCATCGGGCAAGGTCACACCACTTTCCTAATCTAAGCAAGATTAAAATCTATGAGGCTAGT[A/C]
AAGTGTAGTACAAGTCCCGGTGCTCAATAACCGCGAGCACGACTATTCGAATAGATTTGATTTACTCACACTGCAATGGATGTACGCTTTTAATCCCGCA
TGCGGGATTAAAAGCGTACATCCATTGCAGTGTGAGTAAATCAAATCTATTCGAATAGTCGTGCTCGCGGTTATTGAGCACCGGGACTTGTACTACACTT[T/G]
ACTAGCCTCATAGATTTTAATCTTGCTTAGATTAGGAAAGTGGTGTGACCTTGCCCGATGGGCGGGAAGGTTGTCGCGACCGGGAAAATTGCCTTTTCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.50% | 13.30% | 19.61% | 19.61% | NA |
| All Indica | 2759 | 46.20% | 2.80% | 24.61% | 26.42% | NA |
| All Japonica | 1512 | 50.90% | 35.20% | 12.50% | 1.39% | NA |
| Aus | 269 | 52.00% | 0.40% | 10.78% | 36.80% | NA |
| Indica I | 595 | 60.70% | 4.40% | 22.35% | 12.61% | NA |
| Indica II | 465 | 19.40% | 3.70% | 36.99% | 40.00% | NA |
| Indica III | 913 | 52.00% | 0.20% | 19.93% | 27.82% | NA |
| Indica Intermediate | 786 | 44.40% | 3.90% | 24.43% | 27.23% | NA |
| Temperate Japonica | 767 | 27.20% | 55.10% | 16.82% | 0.78% | NA |
| Tropical Japonica | 504 | 84.90% | 5.60% | 7.14% | 2.38% | NA |
| Japonica Intermediate | 241 | 55.20% | 33.60% | 9.96% | 1.24% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 16.67% | 62.50% | NA |
| Intermediate | 90 | 44.40% | 20.00% | 15.56% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727217188 | A -> DEL | N | N | silent_mutation | Average:35.345; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg0727217188 | A -> C | LOC_Os07g45600.1 | upstream_gene_variant ; 2154.0bp to feature; MODIFIER | silent_mutation | Average:35.345; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg0727217188 | A -> C | LOC_Os07g45590.1 | downstream_gene_variant ; 4074.0bp to feature; MODIFIER | silent_mutation | Average:35.345; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| vg0727217188 | A -> C | LOC_Os07g45610.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.345; most accessible tissue: Zhenshan97 panicle, score: 71.253 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727217188 | NA | 7.47E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 6.93E-08 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 1.51E-06 | mr1606 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 1.16E-08 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | 5.18E-06 | 1.44E-08 | mr1942 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 7.44E-09 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 1.89E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 4.90E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 3.76E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 1.09E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 5.55E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 1.71E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727217188 | NA | 2.81E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |