\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727171704:

Variant ID: vg0727171704 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27171704
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.18, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTATATTAAAAATGGCACAAACTCCCCAAAAGTAGCGTTTTATCAAGGGTGACAATGACAATGCAGTAAATGGCATTTTATCGAATCCAAACTTAAA[T/G]
AAAACAGTGGTGTATGATTAATTTTTTTTTCTCTCTTTTCCACCCCTCTGTTAGTCTAAATTCTCTCTGCAAAATAGCCTACGAAGAAATCCAAAAACAA

Reverse complement sequence

TTGTTTTTGGATTTCTTCGTAGGCTATTTTGCAGAGAGAATTTAGACTAACAGAGGGGTGGAAAAGAGAGAAAAAAAAATTAATCATACACCACTGTTTT[A/C]
TTTAAGTTTGGATTCGATAAAATGCCATTTACTGCATTGTCATTGTCACCCTTGATAAAACGCTACTTTTGGGGAGTTTGTGCCATTTTTAATATAGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.80% 30.50% 5.40% 25.31% NA
All Indica  2759 11.50% 45.30% 7.21% 35.96% NA
All Japonica  1512 96.80% 1.30% 0.07% 1.92% NA
Aus  269 3.00% 50.20% 5.58% 41.26% NA
Indica I  595 10.80% 57.00% 4.71% 27.56% NA
Indica II  465 11.00% 19.10% 11.61% 58.28% NA
Indica III  913 3.10% 60.40% 6.79% 29.79% NA
Indica Intermediate  786 22.10% 34.60% 7.00% 36.26% NA
Temperate Japonica  767 99.00% 0.10% 0.00% 0.91% NA
Tropical Japonica  504 94.00% 2.40% 0.00% 3.57% NA
Japonica Intermediate  241 95.40% 2.50% 0.41% 1.66% NA
VI/Aromatic  96 1.00% 16.70% 37.50% 44.79% NA
Intermediate  90 50.00% 22.20% 4.44% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727171704 T -> DEL N N silent_mutation Average:34.156; most accessible tissue: Callus, score: 76.043 N N N N
vg0727171704 T -> G LOC_Os07g45550.1 upstream_gene_variant ; 507.0bp to feature; MODIFIER silent_mutation Average:34.156; most accessible tissue: Callus, score: 76.043 N N N N
vg0727171704 T -> G LOC_Os07g45540-LOC_Os07g45550 intergenic_region ; MODIFIER silent_mutation Average:34.156; most accessible tissue: Callus, score: 76.043 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727171704 NA 1.43E-06 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 3.05E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 1.36E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 4.15E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 6.85E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 1.45E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 6.66E-19 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 5.46E-07 1.02E-10 mr1369_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 1.46E-06 4.42E-11 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 1.47E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 5.38E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 9.96E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 3.03E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 6.44E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 7.78E-06 5.32E-07 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 1.39E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 2.89E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 2.69E-23 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 8.07E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 6.50E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 7.28E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 1.85E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 1.03E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727171704 NA 1.61E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251