Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727131485:

Variant ID: vg0727131485 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 27131485
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGATCCCGTGCAGTGCAGTACTGCTCACTGACATGTGGTCCTGAGGGGCTGTGGGGCCCACATGTTAGTGAGCAGTATTGCAGACGACCAGCATCCCC[A/G]
TTCTCGGTTGAAAGGGCGGGGCAACGCCCTCGGCACGCTGGCGTTCATTTGGGCCACTGTCATCCTCCTCGGAGGGTATCCCGACAAGTGTCACCTTCGA

Reverse complement sequence

TCGAAGGTGACACTTGTCGGGATACCCTCCGAGGAGGATGACAGTGGCCCAAATGAACGCCAGCGTGCCGAGGGCGTTGCCCCGCCCTTTCAACCGAGAA[T/C]
GGGGATGCTGGTCGTCTGCAATACTGCTCACTAACATGTGGGCCCCACAGCCCCTCAGGACCACATGTCAGTGAGCAGTACTGCACTGCACGGGATCTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 12.00% 7.79% 6.31% NA
All Indica  2759 80.00% 3.10% 6.85% 10.04% NA
All Japonica  1512 58.00% 30.60% 11.38% 0.07% NA
Aus  269 92.90% 0.70% 1.12% 5.20% NA
Indica I  595 89.10% 1.50% 6.55% 2.86% NA
Indica II  465 75.90% 4.50% 5.81% 13.76% NA
Indica III  913 78.90% 2.70% 4.60% 13.80% NA
Indica Intermediate  786 77.00% 3.80% 10.31% 8.91% NA
Temperate Japonica  767 32.20% 49.90% 17.73% 0.13% NA
Tropical Japonica  504 95.60% 2.60% 1.79% 0.00% NA
Japonica Intermediate  241 61.40% 27.40% 11.20% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 68.90% 21.10% 4.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727131485 A -> DEL N N silent_mutation Average:70.971; most accessible tissue: Callus, score: 94.981 N N N N
vg0727131485 A -> G LOC_Os07g45480.1 upstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:70.971; most accessible tissue: Callus, score: 94.981 N N N N
vg0727131485 A -> G LOC_Os07g45470.1 downstream_gene_variant ; 2200.0bp to feature; MODIFIER silent_mutation Average:70.971; most accessible tissue: Callus, score: 94.981 N N N N
vg0727131485 A -> G LOC_Os07g45470-LOC_Os07g45480 intergenic_region ; MODIFIER silent_mutation Average:70.971; most accessible tissue: Callus, score: 94.981 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727131485 A G 0.19 0.2 0.17 0.12 0.1 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727131485 NA 1.74E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 2.95E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 1.85E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 7.86E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 9.79E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 7.85E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 4.50E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 6.43E-06 3.20E-09 mr1942 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 6.80E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 8.65E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 7.03E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 1.41E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 6.50E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 9.68E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727131485 NA 3.64E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251