\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727126260:

Variant ID: vg0727126260 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 27126260
Reference Allele: TAAAAlternative Allele: AAAA,T,TAAAA,TAA
Primary Allele: TAAASecondary Allele: AAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCAATACGGCCCATTTGTTTTCAGAGGGGCCTGTAGTCCTCTGGACCGGTGGGCCGTCACTCCCACGAACCTTTTTTAAAGAATCGCAATGAACTTTTT[TAAA/AAAA,T,TAAAA,TAA]
AAAAACATTGCACATGGTATTATTTCGAGGTTTTATTACATTATTAGCAAATGTTGAATGTGGTTTTATTTGATGTTTCAAAAGTTACAAATTGATGTTT

Reverse complement sequence

AAACATCAATTTGTAACTTTTGAAACATCAAATAAAACCACATTCAACATTTGCTAATAATGTAATAAAACCTCGAAATAATACCATGTGCAATGTTTTT[TTTA/TTTT,A,TTTTA,TTA]
AAAAAGTTCATTGCGATTCTTTAAAAAAGGTTCGTGGGAGTGACGGCCCACCGGTCCAGAGGACTACAGGCCCCTCTGAAAACAAATGGGCCGTATTGCG

Allele Frequencies:

Populations Population SizeFrequency of TAAA(primary allele) Frequency of AAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 41.10% 5.06% 0.00% TAAAA: 2.62%; T: 2.37%; TAA: 0.02%
All Indica  2759 63.80% 31.80% 3.08% 0.00% TAAAA: 0.80%; T: 0.54%
All Japonica  1512 29.60% 60.00% 9.52% 0.00% TAAAA: 0.53%; T: 0.33%
Aus  269 19.00% 45.40% 0.37% 0.00% TAAAA: 34.57%; T: 0.74%
Indica I  595 39.50% 56.50% 4.03% 0.00% NA
Indica II  465 83.90% 12.00% 3.01% 0.00% T: 1.08%
Indica III  913 72.60% 26.00% 0.33% 0.00% T: 0.55%; TAAAA: 0.55%
Indica Intermediate  786 60.20% 31.40% 5.60% 0.00% TAAAA: 2.16%; T: 0.64%
Temperate Japonica  767 47.20% 39.50% 13.30% 0.00% NA
Tropical Japonica  504 5.60% 90.70% 2.38% 0.00% TAAAA: 0.99%; T: 0.40%
Japonica Intermediate  241 24.10% 61.00% 12.45% 0.00% T: 1.24%; TAAAA: 1.24%
VI/Aromatic  96 10.40% 5.20% 2.08% 0.00% T: 82.29%
Intermediate  90 41.10% 36.70% 7.78% 0.00% T: 12.22%; TAAAA: 1.11%; TAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0727126260 TAAA -> TAA LOC_Os07g45470.1 upstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> TAA LOC_Os07g45460.1 downstream_gene_variant ; 1418.0bp to feature; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> TAA LOC_Os07g45460-LOC_Os07g45470 intergenic_region ; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> TAAAA LOC_Os07g45470.1 upstream_gene_variant ; 1115.0bp to feature; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> TAAAA LOC_Os07g45460.1 downstream_gene_variant ; 1419.0bp to feature; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> TAAAA LOC_Os07g45460-LOC_Os07g45470 intergenic_region ; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> AAAA LOC_Os07g45470.1 upstream_gene_variant ; 1119.0bp to feature; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> AAAA LOC_Os07g45460.1 downstream_gene_variant ; 1415.0bp to feature; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> AAAA LOC_Os07g45460-LOC_Os07g45470 intergenic_region ; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> T LOC_Os07g45470.1 upstream_gene_variant ; 1118.0bp to feature; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> T LOC_Os07g45460.1 downstream_gene_variant ; 1416.0bp to feature; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N
vg0727126260 TAAA -> T LOC_Os07g45460-LOC_Os07g45470 intergenic_region ; MODIFIER silent_mutation Average:72.937; most accessible tissue: Minghui63 young leaf, score: 94.489 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0727126260 TAAA AAAA -0.01 -0.01 -0.02 -0.01 -0.02 -0.02
vg0727126260 TAAA T -0.43 -0.52 -0.42 -0.4 -0.39 -0.39
vg0727126260 TAAA TAA 0.01 -0.02 -0.01 0.0 0.0 0.0
vg0727126260 TAAA TAAAA 0.05 0.04 0.07 0.05 0.08 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0727126260 NA 2.64E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 9.70E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 3.46E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 8.16E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 8.96E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 4.45E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 5.28E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 1.46E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 1.20E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 2.30E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 1.72E-06 1.71E-06 mr1972_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727126260 NA 6.85E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251