\
| Variant ID: vg0727066911 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 27066911 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 245. )
GATTCGCATGCCGCAAAAAAAGGTTGTCCCAAACATATTTTGTATGAAGAAGGGGCTGAGAAACCAAAATTTTAGCTTCTTATTTAGGATATCTGTTTTC[A/G]
CCAGATATTTGATTCTAGAGTCTAACTTACATGATGCTGCGTTATACCGTCTACAGGTGTTGGGACAAGTAATGGATGCAGAGGGAAAAGAACTCGAGGT
ACCTCGAGTTCTTTTCCCTCTGCATCCATTACTTGTCCCAACACCTGTAGACGGTATAACGCAGCATCATGTAAGTTAGACTCTAGAATCAAATATCTGG[T/C]
GAAAACAGATATCCTAAATAAGAAGCTAAAATTTTGGTTTCTCAGCCCCTTCTTCATACAAAATATGTTTGGGACAACCTTTTTTTGCGGCATGCGAATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.30% | 34.70% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 90.90% | 9.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 11.00% | 89.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.50% | 20.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 24.80% | 75.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 13.30% | 86.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0727066911 | A -> G | LOC_Os07g45370.1 | upstream_gene_variant ; 4627.0bp to feature; MODIFIER | silent_mutation | Average:44.277; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg0727066911 | A -> G | LOC_Os07g45400.1 | upstream_gene_variant ; 3071.0bp to feature; MODIFIER | silent_mutation | Average:44.277; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| vg0727066911 | A -> G | LOC_Os07g45370-LOC_Os07g45400 | intergenic_region ; MODIFIER | silent_mutation | Average:44.277; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0727066911 | NA | 5.00E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0727066911 | NA | 1.01E-06 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 2.90E-17 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 1.09E-14 | mr1258_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 7.81E-08 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 3.19E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 2.40E-15 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 3.90E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 1.18E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 1.11E-19 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 2.37E-18 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 1.63E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0727066911 | NA | 5.65E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |