Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0727066911:

Variant ID: vg0727066911 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27066911
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCGCATGCCGCAAAAAAAGGTTGTCCCAAACATATTTTGTATGAAGAAGGGGCTGAGAAACCAAAATTTTAGCTTCTTATTTAGGATATCTGTTTTC[A/G]
CCAGATATTTGATTCTAGAGTCTAACTTACATGATGCTGCGTTATACCGTCTACAGGTGTTGGGACAAGTAATGGATGCAGAGGGAAAAGAACTCGAGGT

Reverse complement sequence

ACCTCGAGTTCTTTTCCCTCTGCATCCATTACTTGTCCCAACACCTGTAGACGGTATAACGCAGCATCATGTAAGTTAGACTCTAGAATCAAATATCTGG[T/C]
GAAAACAGATATCCTAAATAAGAAGCTAAAATTTTGGTTTCTCAGCCCCTTCTTCATACAAAATATGTTTGGGACAACCTTTTTTTGCGGCATGCGAATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	34.70%	0.04%	0.00%	NA
All Indica	2759	90.90%	9.00%	0.07%	0.00%	NA
All Japonica	1512	11.00%	89.00%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	91.80%	8.20%	0.00%	0.00%	NA
Indica II	465	95.90%	4.10%	0.00%	0.00%	NA
Indica III	913	97.60%	2.40%	0.00%	0.00%	NA
Indica Intermediate	786	79.50%	20.20%	0.25%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	24.80%	75.20%	0.00%	0.00%	NA
Japonica Intermediate	241	13.30%	86.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727066911	A -> G	LOC_Os07g45370.1	upstream_gene_variant ; 4627.0bp to feature; MODIFIER	silent_mutation	Average:44.277; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg0727066911	A -> G	LOC_Os07g45400.1	upstream_gene_variant ; 3071.0bp to feature; MODIFIER	silent_mutation	Average:44.277; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg0727066911	A -> G	LOC_Os07g45370-LOC_Os07g45400	intergenic_region ; MODIFIER	silent_mutation	Average:44.277; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727066911	NA	5.00E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727066911	NA	1.01E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	2.90E-17	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	1.09E-14	mr1258_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	7.81E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	3.19E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	2.40E-15	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	3.90E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	1.18E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	1.11E-19	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	2.37E-18	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	1.63E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727066911	NA	5.65E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251