Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0727043700:

Variant ID: vg0727043700 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 27043700
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

GTCTCGTATTCGCTCCGTATCTGTATTCGATAATATTCGATTTCATTTCCGTATCCGAGTTTTCGATTCCGATTCCGAAAAAAATATGAAAACGAATATG[T/A]
TAAAGCTAGTTTCCGTCCGTTTCCGATCCGTTTCAATCCCTAGCTTCAGCTAATACCGGAGAGATTGCCCACCTGGAACAAAAAGAGAAGGTGAAATGCG

Reverse complement sequence

CGCATTTCACCTTCTCTTTTTGTTCCAGGTGGGCAATCTCTCCGGTATTAGCTGAAGCTAGGGATTGAAACGGATCGGAAACGGACGGAAACTAGCTTTA[A/T]
CATATTCGTTTTCATATTTTTTTCGGAATCGGAATCGAAAACTCGGATACGGAAATGAAATCGAATATTATCGAATACAGATACGGAGCGAATACGAGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.60%	35.30%	0.06%	0.00%	NA
All Indica	2759	90.80%	9.10%	0.07%	0.00%	NA
All Japonica	1512	9.30%	90.70%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	91.90%	8.10%	0.00%	0.00%	NA
Indica II	465	95.70%	4.10%	0.22%	0.00%	NA
Indica III	913	97.60%	2.40%	0.00%	0.00%	NA
Indica Intermediate	786	79.10%	20.70%	0.13%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	19.20%	80.80%	0.00%	0.00%	NA
Japonica Intermediate	241	14.10%	85.90%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	54.40%	44.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0727043700	T -> A	LOC_Os07g45330.1	3_prime_UTR_variant ; 50.0bp to feature; MODIFIER	silent_mutation	Average:37.978; most accessible tissue: Callus, score: 61.826	N	N	N	N
vg0727043700	T -> A	LOC_Os07g45320.1	downstream_gene_variant ; 1729.0bp to feature; MODIFIER	silent_mutation	Average:37.978; most accessible tissue: Callus, score: 61.826	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0727043700	NA	2.17E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0727043700	NA	5.15E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	5.07E-06	4.27E-07	mr1186	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	9.16E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	2.06E-06	1.29E-07	mr1639	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	2.07E-06	1.18E-06	mr1735	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	5.09E-06	5.09E-06	mr1785	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	2.46E-17	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	6.61E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	7.89E-14	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	5.13E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	2.12E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	3.52E-06	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	8.04E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	7.34E-15	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	5.06E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	4.34E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	1.40E-19	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	7.40E-19	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0727043700	NA	8.27E-11	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251