\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726989309:

Variant ID: vg0726989309 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26989309
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.26, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATAAGAAGAATTGCTTCATACAAGACAAAGCTTGCAAACACCTGAACATCGAGGATAATTATCATCAGCTTGTTCCAGGAGGAAGAATCGGGAAAGT[C/T]
AGAGTGGGACCCCTTGCAATGCTAGACTATTTTGAAGTCCTTCACAAATGCAATGGAATAGTGACAACAGATGTTCTGGGGGCTGTGGCTGGATTTGCTG

Reverse complement sequence

CAGCAAATCCAGCCACAGCCCCCAGAACATCTGTTGTCACTATTCCATTGCATTTGTGAAGGACTTCAAAATAGTCTAGCATTGCAAGGGGTCCCACTCT[G/A]
ACTTTCCCGATTCTTCCTCCTGGAACAAGCTGATGATAATTATCCTCGATGTTCAGGTGTTTGCAAGCTTTGTCTTGTATGAAGCAATTCTTCTTATCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 36.90% 0.87% 5.06% NA
All Indica  2759 43.60% 48.90% 0.94% 6.52% NA
All Japonica  1512 90.90% 8.60% 0.33% 0.13% NA
Aus  269 21.20% 60.60% 3.35% 14.87% NA
Indica I  595 20.70% 78.50% 0.67% 0.17% NA
Indica II  465 82.20% 14.00% 0.00% 3.87% NA
Indica III  913 30.00% 54.40% 2.08% 13.47% NA
Indica Intermediate  786 53.90% 40.80% 0.38% 4.83% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 81.50% 17.30% 0.99% 0.20% NA
Japonica Intermediate  241 86.70% 12.90% 0.00% 0.41% NA
VI/Aromatic  96 12.50% 72.90% 0.00% 14.58% NA
Intermediate  90 62.20% 33.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726989309 C -> DEL N N silent_mutation Average:72.672; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N
vg0726989309 C -> T LOC_Os07g45210.1 downstream_gene_variant ; 976.0bp to feature; MODIFIER silent_mutation Average:72.672; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N
vg0726989309 C -> T LOC_Os07g45210.2 downstream_gene_variant ; 957.0bp to feature; MODIFIER silent_mutation Average:72.672; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N
vg0726989309 C -> T LOC_Os07g45210-LOC_Os07g45194 intergenic_region ; MODIFIER silent_mutation Average:72.672; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726989309 NA 3.74E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 1.91E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 1.14E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 1.47E-06 mr1057 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 1.93E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 1.46E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 7.76E-07 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 7.33E-07 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 5.51E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 1.18E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 5.68E-07 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 3.64E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 4.45E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 2.09E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 8.42E-06 mr1735 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 1.30E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 4.69E-06 mr1866 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 3.09E-06 3.09E-06 mr1978 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 6.45E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 9.36E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 6.14E-08 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 2.57E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726989309 NA 1.62E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251