Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726932825:

Variant ID: vg0726932825 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26932825
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTTCATCACATCAACCTATTATACACATACAACTTTTCAGTCACATCATCTCTGATTTCAACCAAAATCCAAACTTTGATCCAACTAAACACGGCCA[C/T]
TGTCATGTCTGAACCTCCATAGACACAGAAAATTCAGAGATGGTGCCGAAGATGCCAGATAATCAATCACAAGCCGCGGTTACCAAATGTAGATCGCGGA

Reverse complement sequence

TCCGCGATCTACATTTGGTAACCGCGGCTTGTGATTGATTATCTGGCATCTTCGGCACCATCTCTGAATTTTCTGTGTCTATGGAGGTTCAGACATGACA[G/A]
TGGCCGTGTTTAGTTGGATCAAAGTTTGGATTTTGGTTGAAATCAGAGATGATGTGACTGAAAAGTTGTATGTGTATAATAGGTTGATGTGATGAAAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 14.10% 0.06% 0.00% NA
All Indica  2759 95.90% 4.10% 0.00% 0.00% NA
All Japonica  1512 69.80% 30.00% 0.20% 0.00% NA
Aus  269 66.90% 33.10% 0.00% 0.00% NA
Indica I  595 94.80% 5.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 61.80% 37.90% 0.26% 0.00% NA
Tropical Japonica  504 74.00% 25.80% 0.20% 0.00% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726932825 C -> T LOC_Os07g45120.1 upstream_gene_variant ; 1486.0bp to feature; MODIFIER silent_mutation Average:64.237; most accessible tissue: Zhenshan97 root, score: 85.912 N N N N
vg0726932825 C -> T LOC_Os07g45110.1 downstream_gene_variant ; 4560.0bp to feature; MODIFIER silent_mutation Average:64.237; most accessible tissue: Zhenshan97 root, score: 85.912 N N N N
vg0726932825 C -> T LOC_Os07g45110-LOC_Os07g45120 intergenic_region ; MODIFIER silent_mutation Average:64.237; most accessible tissue: Zhenshan97 root, score: 85.912 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0726932825 C T -0.12 -0.1 -0.07 -0.05 -0.09 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726932825 NA 2.17E-08 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 9.67E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 6.28E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 5.59E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 2.46E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 2.03E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 4.37E-06 mr1381_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 8.04E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 6.75E-07 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 8.53E-06 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 8.16E-08 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 2.19E-06 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726932825 NA 9.85E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251