\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726931180:

Variant ID: vg0726931180 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26931180
Reference Allele: GAlternative Allele: A,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATCATTAATAGTTTCATTTTTTTTACCGAACTAATGGTCACTTTACTTTCTACTTATCACTCCGTCCCATAATATAAGGGATTTTAAGTTTTTGCTT[G/A,T]
CACTGTTTGACCACTCGTTTTATTCAAAAAATTTATACAAATATAAAAAAACGAAAGGTTGTGCTTAAAGTACTTTTGATAATAAAGTAAGTCAAAAAAT

Reverse complement sequence

ATTTTTTGACTTACTTTATTATCAAAAGTACTTTAAGCACAACCTTTCGTTTTTTTATATTTGTATAAATTTTTTGAATAAAACGAGTGGTCAAACAGTG[C/T,A]
AAGCAAAAACTTAAAATCCCTTATATTATGGGACGGAGTGATAAGTAGAAAGTAAAGTGACCATTAGTTCGGTAAAAAAAATGAAACTATTAATGATTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.20% 39.20% 0.59% 0.00% NA
All Indica  2759 90.40% 8.90% 0.69% 0.00% NA
All Japonica  1512 2.30% 97.40% 0.33% 0.00% NA
Aus  269 64.30% 34.90% 0.74% 0.00% NA
Indica I  595 91.60% 6.40% 2.02% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 92.10% 7.70% 0.22% 0.00% NA
Indica Intermediate  786 84.00% 15.40% 0.64% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 4.00% 95.00% 0.99% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726931180 G -> A LOC_Os07g45120.1 upstream_gene_variant ; 3131.0bp to feature; MODIFIER silent_mutation Average:58.353; most accessible tissue: Callus, score: 89.502 N N N N
vg0726931180 G -> A LOC_Os07g45110.1 downstream_gene_variant ; 2915.0bp to feature; MODIFIER silent_mutation Average:58.353; most accessible tissue: Callus, score: 89.502 N N N N
vg0726931180 G -> A LOC_Os07g45110-LOC_Os07g45120 intergenic_region ; MODIFIER silent_mutation Average:58.353; most accessible tissue: Callus, score: 89.502 N N N N
vg0726931180 G -> T LOC_Os07g45120.1 upstream_gene_variant ; 3131.0bp to feature; MODIFIER N Average:58.353; most accessible tissue: Callus, score: 89.502 N N N N
vg0726931180 G -> T LOC_Os07g45110.1 downstream_gene_variant ; 2915.0bp to feature; MODIFIER N Average:58.353; most accessible tissue: Callus, score: 89.502 N N N N
vg0726931180 G -> T LOC_Os07g45110-LOC_Os07g45120 intergenic_region ; MODIFIER N Average:58.353; most accessible tissue: Callus, score: 89.502 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726931180 NA 5.67E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 1.92E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 3.76E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 4.18E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 7.62E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 5.85E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 5.54E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 1.06E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 7.81E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 6.50E-06 1.25E-06 mr1298_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 2.70E-06 7.27E-09 mr1318_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 8.38E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 4.05E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 1.03E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 1.53E-06 mr1466_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 8.23E-08 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 9.63E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 1.17E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 6.78E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 2.99E-07 mr1702_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 3.67E-06 mr1713_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 5.90E-08 mr1729_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 2.21E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 2.13E-06 mr1731_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 9.88E-06 9.88E-06 mr1736_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 1.45E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 4.12E-06 mr1751_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 5.27E-06 8.80E-09 mr1788_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 3.01E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 5.79E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 5.52E-06 mr1890_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726931180 NA 1.38E-10 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251