\
| Variant ID: vg0726930454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26930454 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 109. )
ACCATACCATTTTTTTTAGAGTAAAGTTATCAAATATGTGTATCCATTTAGTTTCTTGTCAAACTTTGATAAATATATAAGAAATCCTACCAAAATTTTG[G/A]
CAATATTACCAAAATTTTGGCATTGCTAAAATTTAGTAAGGTTTATTTTGGTTGCAATCTAAACAACCCCGTCTAATTATACAATTTTGATGCTAGATAT
ATATCTAGCATCAAAATTGTATAATTAGACGGGGTTGTTTAGATTGCAACCAAAATAAACCTTACTAAATTTTAGCAATGCCAAAATTTTGGTAATATTG[C/T]
CAAAATTTTGGTAGGATTTCTTATATATTTATCAAAGTTTGACAAGAAACTAAATGGATACACATATTTGATAACTTTACTCTAAAAAAAATGGTATGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 14.00% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 4.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 70.00% | 30.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 8.80% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 61.80% | 38.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.60% | 25.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726930454 | G -> A | LOC_Os07g45120.1 | upstream_gene_variant ; 3857.0bp to feature; MODIFIER | silent_mutation | Average:35.141; most accessible tissue: Callus, score: 68.722 | N | N | N | N |
| vg0726930454 | G -> A | LOC_Os07g45110.1 | downstream_gene_variant ; 2189.0bp to feature; MODIFIER | silent_mutation | Average:35.141; most accessible tissue: Callus, score: 68.722 | N | N | N | N |
| vg0726930454 | G -> A | LOC_Os07g45110-LOC_Os07g45120 | intergenic_region ; MODIFIER | silent_mutation | Average:35.141; most accessible tissue: Callus, score: 68.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726930454 | NA | 7.06E-06 | mr1061_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 4.67E-09 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 8.44E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 7.58E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 1.86E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 2.42E-07 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 3.42E-06 | mr1260_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 3.18E-06 | mr1298_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 4.69E-07 | mr1318_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 2.79E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 5.25E-06 | mr1381_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 5.93E-06 | mr1421_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 3.90E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 1.22E-09 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 7.71E-09 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 9.50E-06 | mr1661_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 1.16E-08 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 2.34E-08 | mr1702_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | 1.83E-06 | 7.09E-06 | mr1708_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 7.83E-06 | mr1731_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 2.79E-06 | mr1768_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 3.73E-06 | mr1788_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 5.58E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 5.03E-06 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726930454 | NA | 4.04E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |