\
| Variant ID: vg0726879296 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 26879296 |
| Reference Allele: ACT | Alternative Allele: A,ACTCTCT,TCT,ACACTCT,ACTCT,ACACACTCT |
| Primary Allele: ACT | Secondary Allele: TCT |
Inferred Ancestral Allele: Not determined.
AAAATCTGATTTTATTCTCCTTAGGTTTCCGCCGCCACCGCTCACGGAACTACGATCCGACACGCCCTCGCCGCTCCCCCGCCCGCTCGCCTGCACACAC[ACT/A,ACTCTCT,TCT,ACACTCT,ACTCT,ACACACTCT]
CTCTCTCTCTCTCTTCATGTATGTTGTCGGTGGATTTCCCGGATCCTCTTTTTTTTTCCGGCTGTTCCTAAGGGAGAAAACGTGTGATTTTCGGTATCGC
GCGATACCGAAAATCACACGTTTTCTCCCTTAGGAACAGCCGGAAAAAAAAAGAGGATCCGGGAAATCCACCGACAACATACATGAAGAGAGAGAGAGAG[AGT/T,AGAGAGT,AGA,AGAGTGT,AGAGT,AGAGTGTGT]
GTGTGTGCAGGCGAGCGGGCGGGGGAGCGGCGAGGGCGTGTCGGATCGTAGTTCCGTGAGCGGTGGCGGCGGAAACCTAAGGAGAATAAAATCAGATTTT
| Populations | Population Size | Frequency of ACT(primary allele) | Frequency of TCT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.00% | 7.60% | 2.60% | 0.00% | A: 4.74%; ACTCTCT: 3.75%; ACACACTCT: 1.61%; ACACTCT: 0.51%; ACTCT: 0.25% |
| All Indica | 2759 | 95.60% | 0.70% | 0.58% | 0.00% | ACACACTCT: 2.32%; A: 0.40%; ACTCTCT: 0.25%; ACACTCT: 0.11%; ACTCT: 0.04% |
| All Japonica | 1512 | 50.00% | 21.70% | 4.37% | 0.00% | A: 13.82%; ACTCTCT: 8.66%; ACTCT: 0.73%; ACACACTCT: 0.66%; ACACTCT: 0.07% |
| Aus | 269 | 65.10% | 1.10% | 11.90% | 0.00% | ACTCTCT: 14.50%; ACACTCT: 7.06%; ACACACTCT: 0.37% |
| Indica I | 595 | 95.50% | 1.80% | 1.68% | 0.00% | A: 0.84%; ACTCT: 0.17% |
| Indica II | 465 | 96.80% | 0.40% | 0.22% | 0.00% | ACACACTCT: 2.15%; A: 0.43% |
| Indica III | 913 | 94.20% | 0.10% | 0.33% | 0.00% | ACACACTCT: 5.15%; ACACTCT: 0.11%; ACTCTCT: 0.11% |
| Indica Intermediate | 786 | 96.60% | 0.80% | 0.25% | 0.00% | ACACACTCT: 0.89%; ACTCTCT: 0.76%; A: 0.51%; ACACTCT: 0.25% |
| Temperate Japonica | 767 | 65.60% | 1.80% | 4.95% | 0.00% | A: 26.47%; ACTCT: 0.65%; ACTCTCT: 0.52% |
| Tropical Japonica | 504 | 14.10% | 59.10% | 2.58% | 0.00% | ACTCTCT: 21.63%; ACACACTCT: 1.79%; ACTCT: 0.60%; ACACTCT: 0.20% |
| Japonica Intermediate | 241 | 75.50% | 6.60% | 6.22% | 0.00% | ACTCTCT: 7.47%; A: 2.49%; ACTCT: 1.24%; ACACACTCT: 0.41% |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 5.60% | 10.00% | 0.00% | A: 4.44%; ACACACTCT: 1.11%; ACACTCT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726879296 | ACT -> TCT | LOC_Os07g45050.1 | upstream_gene_variant ; 945.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> TCT | LOC_Os07g45060.1 | downstream_gene_variant ; 2784.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> TCT | LOC_Os07g45039-LOC_Os07g45050 | intergenic_region ; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACACACTCT | LOC_Os07g45050.1 | upstream_gene_variant ; 943.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACACACTCT | LOC_Os07g45060.1 | downstream_gene_variant ; 2782.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACACACTCT | LOC_Os07g45039-LOC_Os07g45050 | intergenic_region ; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACTCTCT | LOC_Os07g45050.1 | upstream_gene_variant ; 942.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACTCTCT | LOC_Os07g45060.1 | downstream_gene_variant ; 2781.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACTCTCT | LOC_Os07g45039-LOC_Os07g45050 | intergenic_region ; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACACTCT | LOC_Os07g45050.1 | upstream_gene_variant ; 943.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACACTCT | LOC_Os07g45060.1 | downstream_gene_variant ; 2782.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACACTCT | LOC_Os07g45039-LOC_Os07g45050 | intergenic_region ; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> A | LOC_Os07g45050.1 | upstream_gene_variant ; 944.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> A | LOC_Os07g45060.1 | downstream_gene_variant ; 2783.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> A | LOC_Os07g45039-LOC_Os07g45050 | intergenic_region ; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACTCT | LOC_Os07g45050.1 | upstream_gene_variant ; 942.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACTCT | LOC_Os07g45060.1 | downstream_gene_variant ; 2781.0bp to feature; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg0726879296 | ACT -> ACTCT | LOC_Os07g45039-LOC_Os07g45050 | intergenic_region ; MODIFIER | silent_mutation | Average:55.998; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726879296 | NA | 2.86E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 2.13E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 9.88E-06 | mr1263 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 3.45E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 9.88E-06 | mr1451 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 1.44E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 2.13E-06 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 4.00E-14 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 1.82E-07 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 6.41E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 3.27E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | 3.40E-07 | NA | mr1540_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 1.46E-15 | mr1540_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 5.69E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 2.39E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | 6.66E-07 | NA | mr1732_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 3.12E-14 | mr1732_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 1.13E-07 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 1.18E-09 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 4.32E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726879296 | NA | 2.62E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |