\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726876447:

Variant ID: vg0726876447 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26876447
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGGAGGAATCAAATTGAGAAGGGTTGAAAACAACCTGGGAGTAATACATTTACCTGGTGCAGCTGACCTGCAAAGAATGCAAACATCAAAAAAGACCA[G/A]
CAACGCATAACATGGCTACTAAAAGTATAATTACATCCAGAAAGTATGAGATTGGGCAGTTAGCCATGAAAGCAAGATTGCATTCTAGAAATTAGTCACC

Reverse complement sequence

GGTGACTAATTTCTAGAATGCAATCTTGCTTTCATGGCTAACTGCCCAATCTCATACTTTCTGGATGTAATTATACTTTTAGTAGCCATGTTATGCGTTG[C/T]
TGGTCTTTTTTGATGTTTGCATTCTTTGCAGGTCAGCTGCACCAGGTAAATGTATTACTCCCAGGTTGTTTTCAACCCTTCTCAATTTGATTCCTCCTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.30% 0.21% 0.00% NA
All Indica  2759 98.80% 1.10% 0.07% 0.00% NA
All Japonica  1512 76.80% 22.90% 0.33% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 96.50% 3.50% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 96.70% 3.10% 0.13% 0.00% NA
Tropical Japonica  504 39.50% 60.30% 0.20% 0.00% NA
Japonica Intermediate  241 91.30% 7.50% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 13.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726876447 G -> A LOC_Os07g45030.1 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:55.65; most accessible tissue: Callus, score: 79.703 N N N N
vg0726876447 G -> A LOC_Os07g45050.1 upstream_gene_variant ; 3794.0bp to feature; MODIFIER silent_mutation Average:55.65; most accessible tissue: Callus, score: 79.703 N N N N
vg0726876447 G -> A LOC_Os07g45039.1 downstream_gene_variant ; 2465.0bp to feature; MODIFIER silent_mutation Average:55.65; most accessible tissue: Callus, score: 79.703 N N N N
vg0726876447 G -> A LOC_Os07g45039-LOC_Os07g45050 intergenic_region ; MODIFIER silent_mutation Average:55.65; most accessible tissue: Callus, score: 79.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726876447 NA 5.03E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 1.74E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 9.07E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 1.60E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 3.98E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 1.75E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 7.03E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 4.98E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 4.77E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 8.62E-06 2.61E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 2.74E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 3.87E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 2.26E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 4.14E-07 NA mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 7.33E-06 2.29E-16 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 1.08E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 5.69E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 5.66E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 1.20E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 6.11E-07 NA mr1732_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 2.07E-15 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 7.17E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 9.25E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 4.70E-08 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 2.27E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 4.28E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 7.98E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726876447 NA 1.71E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251