\
| Variant ID: vg0726740555 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26740555 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 90. )
TCTTTGTGGGCGAGTCTAAGTTGTGCCAAGATCTCAATTCAAATCCGTCCTTGATCCCTCTCGTCACCATCAAAAATTGCCTCCTCGAAATTCCTCTTCC[A/G]
ACTCAAGTCTCCAAATCAAACTCTGAAATTCTATCCCTCTCTTTGAATCATCGCCAAATACTTCCCCAGATCCAAAATATCCAAAACCCCATCTTGAATC
GATTCAAGATGGGGTTTTGGATATTTTGGATCTGGGGAAGTATTTGGCGATGATTCAAAGAGAGGGATAGAATTTCAGAGTTTGATTTGGAGACTTGAGT[T/C]
GGAAGAGGAATTTCGAGGAGGCAATTTTTGATGGTGACGAGAGGGATCAAGGACGGATTTGAATTGAGATCTTGGCACAACTTAGACTCGCCCACAAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.50% | 12.20% | 5.40% | 9.97% | NA |
| All Indica | 2759 | 98.20% | 1.20% | 0.47% | 0.22% | NA |
| All Japonica | 1512 | 19.30% | 34.70% | 15.34% | 30.62% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.30% | 1.80% | 0.67% | 0.17% | NA |
| Indica II | 465 | 98.30% | 1.10% | 0.22% | 0.43% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 2.00% | 1.02% | 0.38% | NA |
| Temperate Japonica | 767 | 5.50% | 56.10% | 6.13% | 32.33% | NA |
| Tropical Japonica | 504 | 36.50% | 5.80% | 23.81% | 33.93% | NA |
| Japonica Intermediate | 241 | 27.40% | 27.40% | 26.97% | 18.26% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 18.90% | 10.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726740555 | A -> DEL | N | N | silent_mutation | Average:22.451; most accessible tissue: Callus, score: 51.48 | N | N | N | N |
| vg0726740555 | A -> G | LOC_Os07g44800.1 | downstream_gene_variant ; 2021.0bp to feature; MODIFIER | silent_mutation | Average:22.451; most accessible tissue: Callus, score: 51.48 | N | N | N | N |
| vg0726740555 | A -> G | LOC_Os07g44810.1 | downstream_gene_variant ; 515.0bp to feature; MODIFIER | silent_mutation | Average:22.451; most accessible tissue: Callus, score: 51.48 | N | N | N | N |
| vg0726740555 | A -> G | LOC_Os07g44800-LOC_Os07g44810 | intergenic_region ; MODIFIER | silent_mutation | Average:22.451; most accessible tissue: Callus, score: 51.48 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726740555 | NA | 2.14E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726740555 | 2.88E-06 | 2.88E-06 | mr1853 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726740555 | NA | 1.84E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726740555 | NA | 1.51E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726740555 | NA | 4.34E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726740555 | NA | 5.34E-07 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |