Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726739458:

Variant ID: vg0726739458 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26739458
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTGAGGCGTAGGTGATCATGAGATGGATGAGATCCAAGGTTGATAAAACACCGTACGGTTACCACGCGATTATCATGCGCTGTAACCTTTTCAGTTTT[C/T]
AAAATCACGGTATATACCTTAACCGTTAAACTGTAGTGTAGGGTGATGATAACTTTACGCCAAACGGTTTGGTAGACCTAAATGGGATCTCGCGCGAGGC

Reverse complement sequence

GCCTCGCGCGAGATCCCATTTAGGTCTACCAAACCGTTTGGCGTAAAGTTATCATCACCCTACACTACAGTTTAACGGTTAAGGTATATACCGTGATTTT[G/A]
AAAACTGAAAAGGTTACAGCGCATGATAATCGCGTGGTAACCGTACGGTGTTTTATCAACCTTGGATCTCATCCATCTCATGATCACCTACGCCTCAGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.10% 0.19% 0.59% NA
All Indica  2759 77.00% 22.10% 0.11% 0.76% NA
All Japonica  1512 44.60% 55.00% 0.13% 0.26% NA
Aus  269 82.90% 17.10% 0.00% 0.00% NA
Indica I  595 94.30% 5.50% 0.00% 0.17% NA
Indica II  465 71.60% 26.90% 0.22% 1.29% NA
Indica III  913 64.30% 35.40% 0.00% 0.33% NA
Indica Intermediate  786 81.90% 16.40% 0.25% 1.40% NA
Temperate Japonica  767 60.20% 39.80% 0.00% 0.00% NA
Tropical Japonica  504 24.60% 75.00% 0.00% 0.40% NA
Japonica Intermediate  241 36.50% 61.80% 0.83% 0.83% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 54.40% 37.80% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726739458 C -> DEL N N silent_mutation Average:98.324; most accessible tissue: Callus, score: 99.82 N N N N
vg0726739458 C -> T LOC_Os07g44800.1 downstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:98.324; most accessible tissue: Callus, score: 99.82 N N N N
vg0726739458 C -> T LOC_Os07g44810.1 downstream_gene_variant ; 1612.0bp to feature; MODIFIER silent_mutation Average:98.324; most accessible tissue: Callus, score: 99.82 N N N N
vg0726739458 C -> T LOC_Os07g44800-LOC_Os07g44810 intergenic_region ; MODIFIER silent_mutation Average:98.324; most accessible tissue: Callus, score: 99.82 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0726739458 C T 0.1 0.04 0.01 0.06 0.03 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726739458 NA 3.63E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 1.25E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 4.18E-07 mr1648 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 2.13E-08 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 5.67E-06 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 1.33E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 9.96E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 9.71E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 3.77E-09 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 2.52E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 3.73E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 6.66E-09 mr1866_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726739458 NA 1.87E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251