Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726710010:

Variant ID: vg0726710010 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26710010
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

GCGAGTGTCTATTTCAACTCTTTGAGTGTTCTGGTTCTCAATTGAATACTGGTAACTCAGACTGTTGTTACAGCTCAGTTTAGCCATCCAGGAAATCAAG[C/T]
TTCCATATCTACTCCCTATTAATCTAGTTTGGTTATACACAGCTTCAGTTGTTCAAGTCAAGAACAAGAAAATCCTAAATGGGGAATTCAATACCTACCT

Reverse complement sequence

AGGTAGGTATTGAATTCCCCATTTAGGATTTTCTTGTTCTTGACTTGAACAACTGAAGCTGTGTATAACCAAACTAGATTAATAGGGAGTAGATATGGAA[G/A]
CTTGATTTCCTGGATGGCTAAACTGAGCTGTAACAACAGTCTGAGTTACCAGTATTCAATTGAGAACCAGAACACTCAAAGAGTTGAAATAGACACTCGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.80%	0.00%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	86.80%	13.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	80.10%	19.90%	0.00%	0.00%	NA
Tropical Japonica	504	93.30%	6.70%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726710010	C -> T	LOC_Os07g44730.1	upstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 85.725	N	N	N	N
vg0726710010	C -> T	LOC_Os07g44730.2	upstream_gene_variant ; 4767.0bp to feature; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 85.725	N	N	N	N
vg0726710010	C -> T	LOC_Os07g44740.1	downstream_gene_variant ; 2123.0bp to feature; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 85.725	N	N	N	N
vg0726710010	C -> T	LOC_Os07g44750.1	downstream_gene_variant ; 3050.0bp to feature; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 85.725	N	N	N	N
vg0726710010	C -> T	LOC_Os07g44744.1	intron_variant ; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 85.725	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726710010	NA	2.38E-06	mr1922	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010	NA	2.96E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010	NA	5.57E-06	mr1221_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010	3.50E-06	NA	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010	NA	1.41E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010	NA	5.08E-06	mr1320_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010	NA	3.89E-06	mr1545_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010	3.43E-06	NA	mr1638_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251