\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726710010:

Variant ID: vg0726710010 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26710010
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAGTGTCTATTTCAACTCTTTGAGTGTTCTGGTTCTCAATTGAATACTGGTAACTCAGACTGTTGTTACAGCTCAGTTTAGCCATCCAGGAAATCAAG[C/T]
TTCCATATCTACTCCCTATTAATCTAGTTTGGTTATACACAGCTTCAGTTGTTCAAGTCAAGAACAAGAAAATCCTAAATGGGGAATTCAATACCTACCT

Reverse complement sequence

AGGTAGGTATTGAATTCCCCATTTAGGATTTTCTTGTTCTTGACTTGAACAACTGAAGCTGTGTATAACCAAACTAGATTAATAGGGAGTAGATATGGAA[G/A]
CTTGATTTCCTGGATGGCTAAACTGAGCTGTAACAACAGTCTGAGTTACCAGTATTCAATTGAGAACCAGAACACTCAAAGAGTTGAAATAGACACTCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.80% 0.00% 0.00% NA
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 86.80% 13.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 80.10% 19.90% 0.00% 0.00% NA
Tropical Japonica  504 93.30% 6.70% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726710010 C -> T LOC_Os07g44730.1 upstream_gene_variant ; 4767.0bp to feature; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 85.725 N N N N
vg0726710010 C -> T LOC_Os07g44730.2 upstream_gene_variant ; 4767.0bp to feature; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 85.725 N N N N
vg0726710010 C -> T LOC_Os07g44740.1 downstream_gene_variant ; 2123.0bp to feature; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 85.725 N N N N
vg0726710010 C -> T LOC_Os07g44750.1 downstream_gene_variant ; 3050.0bp to feature; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 85.725 N N N N
vg0726710010 C -> T LOC_Os07g44744.1 intron_variant ; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 85.725 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726710010 NA 2.38E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010 NA 2.96E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010 NA 5.57E-06 mr1221_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010 3.50E-06 NA mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010 NA 1.41E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010 NA 5.08E-06 mr1320_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010 NA 3.89E-06 mr1545_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726710010 3.43E-06 NA mr1638_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251