\
| Variant ID: vg0726710010 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26710010 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 295. )
GCGAGTGTCTATTTCAACTCTTTGAGTGTTCTGGTTCTCAATTGAATACTGGTAACTCAGACTGTTGTTACAGCTCAGTTTAGCCATCCAGGAAATCAAG[C/T]
TTCCATATCTACTCCCTATTAATCTAGTTTGGTTATACACAGCTTCAGTTGTTCAAGTCAAGAACAAGAAAATCCTAAATGGGGAATTCAATACCTACCT
AGGTAGGTATTGAATTCCCCATTTAGGATTTTCTTGTTCTTGACTTGAACAACTGAAGCTGTGTATAACCAAACTAGATTAATAGGGAGTAGATATGGAA[G/A]
CTTGATTTCCTGGATGGCTAAACTGAGCTGTAACAACAGTCTGAGTTACCAGTATTCAATTGAGAACCAGAACACTCAAAGAGTTGAAATAGACACTCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.80% | 13.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726710010 | C -> T | LOC_Os07g44730.1 | upstream_gene_variant ; 4767.0bp to feature; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 85.725 | N | N | N | N |
| vg0726710010 | C -> T | LOC_Os07g44730.2 | upstream_gene_variant ; 4767.0bp to feature; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 85.725 | N | N | N | N |
| vg0726710010 | C -> T | LOC_Os07g44740.1 | downstream_gene_variant ; 2123.0bp to feature; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 85.725 | N | N | N | N |
| vg0726710010 | C -> T | LOC_Os07g44750.1 | downstream_gene_variant ; 3050.0bp to feature; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 85.725 | N | N | N | N |
| vg0726710010 | C -> T | LOC_Os07g44744.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 85.725 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726710010 | NA | 2.38E-06 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726710010 | NA | 2.96E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726710010 | NA | 5.57E-06 | mr1221_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726710010 | 3.50E-06 | NA | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726710010 | NA | 1.41E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726710010 | NA | 5.08E-06 | mr1320_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726710010 | NA | 3.89E-06 | mr1545_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726710010 | 3.43E-06 | NA | mr1638_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |