\
| Variant ID: vg0726691050 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26691050 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )
TTAAGAACTTTATGTTCTGGAAATTATGTCACTTAAAGATTATGATGGGTAAGAAAATCTAAGCATCTGATGAGACACTCTAGAGGAAGCAAACTGCCCT[G/A]
TTGATTTTTATGTGTGAAGGTAGTACATTCCACTTATTGGGTGTCTTTGGATTAGCCACCTATACTCCCTCCTCTTTTTATAGGGCATATTTTATTTTGT
ACAAAATAAAATATGCCCTATAAAAAGAGGAGGGAGTATAGGTGGCTAATCCAAAGACACCCAATAAGTGGAATGTACTACCTTCACACATAAAAATCAA[C/T]
AGGGCAGTTTGCTTCCTCTAGAGTGTCTCATCAGATGCTTAGATTTTCTTACCCATCATAATCTTTAAGTGACATAATTTCCAGAACATAAAGTTCTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 4.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.00% | 0.90% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726691050 | G -> A | LOC_Os07g44710.1 | upstream_gene_variant ; 2223.0bp to feature; MODIFIER | silent_mutation | Average:50.407; most accessible tissue: Callus, score: 89.562 | N | N | N | N |
| vg0726691050 | G -> A | LOC_Os07g44710-LOC_Os07g44730 | intergenic_region ; MODIFIER | silent_mutation | Average:50.407; most accessible tissue: Callus, score: 89.562 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726691050 | 2.22E-06 | NA | mr1922 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726691050 | 2.47E-06 | 7.54E-09 | mr1922 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726691050 | NA | 8.69E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726691050 | NA | 9.66E-06 | mr1221_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726691050 | 2.86E-06 | NA | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726691050 | NA | 5.77E-07 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |