RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0726691050:

Variant ID: vg0726691050 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26691050
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TTAAGAACTTTATGTTCTGGAAATTATGTCACTTAAAGATTATGATGGGTAAGAAAATCTAAGCATCTGATGAGACACTCTAGAGGAAGCAAACTGCCCT[G/A]
TTGATTTTTATGTGTGAAGGTAGTACATTCCACTTATTGGGTGTCTTTGGATTAGCCACCTATACTCCCTCCTCTTTTTATAGGGCATATTTTATTTTGT

Reverse complement sequence

ACAAAATAAAATATGCCCTATAAAAAGAGGAGGGAGTATAGGTGGCTAATCCAAAGACACCCAATAAGTGGAATGTACTACCTTCACACATAAAAATCAA[C/T]
AGGGCAGTTTGCTTCCTCTAGAGTGTCTCATCAGATGCTTAGATTTTCTTACCCATCATAATCTTTAAGTGACATAATTTCCAGAACATAAAGTTCTTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.80%	4.10%	0.02%	0.00%	NA
All Indica	2759	99.00%	0.90%	0.04%	0.00%	NA
All Japonica	1512	89.00%	11.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.10%	3.70%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	80.10%	19.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726691050	G -> A	LOC_Os07g44710.1	upstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:50.407; most accessible tissue: Callus, score: 89.562	N	N	N	N
vg0726691050	G -> A	LOC_Os07g44710-LOC_Os07g44730	intergenic_region ; MODIFIER	silent_mutation	Average:50.407; most accessible tissue: Callus, score: 89.562	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726691050	2.22E-06	NA	mr1922	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726691050	2.47E-06	7.54E-09	mr1922	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726691050	NA	8.69E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726691050	NA	9.66E-06	mr1221_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726691050	2.86E-06	NA	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726691050	NA	5.77E-07	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0726691050:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact