Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726597617:

Variant ID: vg0726597617 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26597617
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCGGTCTTCGTCAGCTTGGTTGCAGGCACTTCTCCTTCGCTTGCCGTGGTCACAGCCAGTCGGATCTCTTCTCGAGCGAGTGTGATCTCGCGGGTTTGGG[C/T]
CATCTCGCAACTTTCTTTGTCACATGTGACGGCCTGCTTGACGTCGCTCCATAGTGATATGACTCCTCGAGGACCAGGCATCTTCATCATCATGTAGGTG

Reverse complement sequence

CACCTACATGATGATGAAGATGCCTGGTCCTCGAGGAGTCATATCACTATGGAGCGACGTCAAGCAGGCCGTCACATGTGACAAAGAAAGTTGCGAGATG[G/A]
CCCAAACCCGCGAGATCACACTCGCTCGAGAAGAGATCCGACTGGCTGTGACCACGGCAAGCGAAGGAGAAGTGCCTGCAACCAAGCTGACGAAGACCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.80%	16.20%	3.13%	1.95%	NA
All Indica	2759	89.80%	5.20%	5.00%	0.00%	NA
All Japonica	1512	59.90%	39.70%	0.07%	0.26%	NA
Aus	269	98.90%	0.40%	0.00%	0.74%	NA
Indica I	595	92.40%	7.20%	0.34%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	86.30%	2.30%	11.39%	0.00%	NA
Indica Intermediate	786	87.00%	9.00%	3.94%	0.00%	NA
Temperate Japonica	767	93.60%	6.40%	0.00%	0.00%	NA
Tropical Japonica	504	14.50%	85.10%	0.00%	0.40%	NA
Japonica Intermediate	241	47.70%	51.00%	0.41%	0.83%	NA
VI/Aromatic	96	14.60%	2.10%	5.21%	78.12%	NA
Intermediate	90	64.40%	18.90%	4.44%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726597617	C -> DEL	LOC_Os07g44540.1	N	frameshift_variant	Average:32.888; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0726597617	C -> T	LOC_Os07g44540.1	missense_variant ; p.Ala924Thr; MODERATE	nonsynonymous_codon ; A924T	Average:32.888; most accessible tissue: Minghui63 panicle, score: 46.754	possibly damaging	1.742	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726597617	NA	1.33E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	1.65E-07	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	3.52E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	1.00E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	2.27E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	1.45E-06	4.00E-08	mr1337_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	1.31E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	6.82E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	7.90E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	4.01E-06	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	7.58E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	6.74E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	1.10E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	2.03E-06	mr1652_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	3.12E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	1.44E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	9.93E-14	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	5.90E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617	NA	2.22E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251