\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726597617:

Variant ID: vg0726597617 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26597617
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGGTCTTCGTCAGCTTGGTTGCAGGCACTTCTCCTTCGCTTGCCGTGGTCACAGCCAGTCGGATCTCTTCTCGAGCGAGTGTGATCTCGCGGGTTTGGG[C/T]
CATCTCGCAACTTTCTTTGTCACATGTGACGGCCTGCTTGACGTCGCTCCATAGTGATATGACTCCTCGAGGACCAGGCATCTTCATCATCATGTAGGTG

Reverse complement sequence

CACCTACATGATGATGAAGATGCCTGGTCCTCGAGGAGTCATATCACTATGGAGCGACGTCAAGCAGGCCGTCACATGTGACAAAGAAAGTTGCGAGATG[G/A]
CCCAAACCCGCGAGATCACACTCGCTCGAGAAGAGATCCGACTGGCTGTGACCACGGCAAGCGAAGGAGAAGTGCCTGCAACCAAGCTGACGAAGACCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.80% 16.20% 3.13% 1.95% NA
All Indica  2759 89.80% 5.20% 5.00% 0.00% NA
All Japonica  1512 59.90% 39.70% 0.07% 0.26% NA
Aus  269 98.90% 0.40% 0.00% 0.74% NA
Indica I  595 92.40% 7.20% 0.34% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 86.30% 2.30% 11.39% 0.00% NA
Indica Intermediate  786 87.00% 9.00% 3.94% 0.00% NA
Temperate Japonica  767 93.60% 6.40% 0.00% 0.00% NA
Tropical Japonica  504 14.50% 85.10% 0.00% 0.40% NA
Japonica Intermediate  241 47.70% 51.00% 0.41% 0.83% NA
VI/Aromatic  96 14.60% 2.10% 5.21% 78.12% NA
Intermediate  90 64.40% 18.90% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726597617 C -> DEL LOC_Os07g44540.1 N frameshift_variant Average:32.888; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0726597617 C -> T LOC_Os07g44540.1 missense_variant ; p.Ala924Thr; MODERATE nonsynonymous_codon ; A924T Average:32.888; most accessible tissue: Minghui63 panicle, score: 46.754 possibly damaging 1.742 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726597617 NA 1.33E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 1.65E-07 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 3.52E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 1.00E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 2.27E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 1.45E-06 4.00E-08 mr1337_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 1.31E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 6.82E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 7.90E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 4.01E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 7.58E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 6.74E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 1.10E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 2.03E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 3.12E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 1.44E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 9.93E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 5.90E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726597617 NA 2.22E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251