Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726584856:

Variant ID: vg0726584856 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26584856
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCCAGAGAACTTGCCAAGAAGAATGAACACGATCTGAGGGATCGGATTGCTGAGCTCCAGGAGTCCAATTTCGAACTGAGTGGCTCGTCAAAAGGTTC[G/A]
CGCAAACTCTGCCTTACTGATTTGTGCTGTTATATCTGTAATCCAGATTAACCGAAGTTAATGTAGTGCAAGCTGCCAAGATATCTCAACTAGAGAAGCA

Reverse complement sequence

TGCTTCTCTAGTTGAGATATCTTGGCAGCTTGCACTACATTAACTTCGGTTAATCTGGATTACAGATATAACAGCACAAATCAGTAAGGCAGAGTTTGCG[C/T]
GAACCTTTTGACGAGCCACTCAGTTCGAAATTGGACTCCTGGAGCTCAGCAATCCGATCCCTCAGATCGTGTTCATTCTTCTTGGCAAGTTCTCTGGCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	21.20%	1.80%	3.51%	NA
All Indica	2759	89.60%	5.30%	2.61%	2.57%	NA
All Japonica	1512	43.70%	55.80%	0.20%	0.26%	NA
Aus	269	98.90%	0.40%	0.00%	0.74%	NA
Indica I	595	92.40%	7.40%	0.00%	0.17%	NA
Indica II	465	97.60%	1.70%	0.22%	0.43%	NA
Indica III	913	86.10%	2.20%	5.70%	6.02%	NA
Indica Intermediate	786	86.60%	9.30%	2.42%	1.65%	NA
Temperate Japonica	767	63.20%	36.80%	0.00%	0.00%	NA
Tropical Japonica	504	15.10%	84.10%	0.40%	0.40%	NA
Japonica Intermediate	241	41.50%	57.30%	0.41%	0.83%	NA
VI/Aromatic	96	16.70%	2.10%	3.12%	78.12%	NA
Intermediate	90	63.30%	13.30%	7.78%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726584856	G -> DEL	N	N	silent_mutation	Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0726584856	G -> A	LOC_Os07g44520.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0726584856	G -> A	LOC_Os07g44499.1	downstream_gene_variant ; 4996.0bp to feature; MODIFIER	silent_mutation	Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0726584856	G -> A	LOC_Os07g44530.1	downstream_gene_variant ; 1026.0bp to feature; MODIFIER	silent_mutation	Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726584856	NA	5.69E-06	mr1401	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	1.11E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	3.17E-06	6.70E-07	mr1708	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	1.92E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	2.12E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	7.31E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	4.72E-08	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	1.46E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	2.81E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	1.06E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	3.28E-06	mr1652_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856	NA	1.65E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251