\
| Variant ID: vg0726584856 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26584856 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 107. )
AGGCCAGAGAACTTGCCAAGAAGAATGAACACGATCTGAGGGATCGGATTGCTGAGCTCCAGGAGTCCAATTTCGAACTGAGTGGCTCGTCAAAAGGTTC[G/A]
CGCAAACTCTGCCTTACTGATTTGTGCTGTTATATCTGTAATCCAGATTAACCGAAGTTAATGTAGTGCAAGCTGCCAAGATATCTCAACTAGAGAAGCA
TGCTTCTCTAGTTGAGATATCTTGGCAGCTTGCACTACATTAACTTCGGTTAATCTGGATTACAGATATAACAGCACAAATCAGTAAGGCAGAGTTTGCG[C/T]
GAACCTTTTGACGAGCCACTCAGTTCGAAATTGGACTCCTGGAGCTCAGCAATCCGATCCCTCAGATCGTGTTCATTCTTCTTGGCAAGTTCTCTGGCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 21.20% | 1.80% | 3.51% | NA |
| All Indica | 2759 | 89.60% | 5.30% | 2.61% | 2.57% | NA |
| All Japonica | 1512 | 43.70% | 55.80% | 0.20% | 0.26% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.00% | 0.74% | NA |
| Indica I | 595 | 92.40% | 7.40% | 0.00% | 0.17% | NA |
| Indica II | 465 | 97.60% | 1.70% | 0.22% | 0.43% | NA |
| Indica III | 913 | 86.10% | 2.20% | 5.70% | 6.02% | NA |
| Indica Intermediate | 786 | 86.60% | 9.30% | 2.42% | 1.65% | NA |
| Temperate Japonica | 767 | 63.20% | 36.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 15.10% | 84.10% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 41.50% | 57.30% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 16.70% | 2.10% | 3.12% | 78.12% | NA |
| Intermediate | 90 | 63.30% | 13.30% | 7.78% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726584856 | G -> DEL | N | N | silent_mutation | Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0726584856 | G -> A | LOC_Os07g44520.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0726584856 | G -> A | LOC_Os07g44499.1 | downstream_gene_variant ; 4996.0bp to feature; MODIFIER | silent_mutation | Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg0726584856 | G -> A | LOC_Os07g44530.1 | downstream_gene_variant ; 1026.0bp to feature; MODIFIER | silent_mutation | Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726584856 | NA | 5.69E-06 | mr1401 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 1.11E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | 3.17E-06 | 6.70E-07 | mr1708 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 1.92E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 2.12E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 7.31E-06 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 4.72E-08 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 1.46E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 2.81E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 1.06E-06 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 3.28E-06 | mr1652_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726584856 | NA | 1.65E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |