\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726584856:

Variant ID: vg0726584856 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26584856
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCCAGAGAACTTGCCAAGAAGAATGAACACGATCTGAGGGATCGGATTGCTGAGCTCCAGGAGTCCAATTTCGAACTGAGTGGCTCGTCAAAAGGTTC[G/A]
CGCAAACTCTGCCTTACTGATTTGTGCTGTTATATCTGTAATCCAGATTAACCGAAGTTAATGTAGTGCAAGCTGCCAAGATATCTCAACTAGAGAAGCA

Reverse complement sequence

TGCTTCTCTAGTTGAGATATCTTGGCAGCTTGCACTACATTAACTTCGGTTAATCTGGATTACAGATATAACAGCACAAATCAGTAAGGCAGAGTTTGCG[C/T]
GAACCTTTTGACGAGCCACTCAGTTCGAAATTGGACTCCTGGAGCTCAGCAATCCGATCCCTCAGATCGTGTTCATTCTTCTTGGCAAGTTCTCTGGCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 21.20% 1.80% 3.51% NA
All Indica  2759 89.60% 5.30% 2.61% 2.57% NA
All Japonica  1512 43.70% 55.80% 0.20% 0.26% NA
Aus  269 98.90% 0.40% 0.00% 0.74% NA
Indica I  595 92.40% 7.40% 0.00% 0.17% NA
Indica II  465 97.60% 1.70% 0.22% 0.43% NA
Indica III  913 86.10% 2.20% 5.70% 6.02% NA
Indica Intermediate  786 86.60% 9.30% 2.42% 1.65% NA
Temperate Japonica  767 63.20% 36.80% 0.00% 0.00% NA
Tropical Japonica  504 15.10% 84.10% 0.40% 0.40% NA
Japonica Intermediate  241 41.50% 57.30% 0.41% 0.83% NA
VI/Aromatic  96 16.70% 2.10% 3.12% 78.12% NA
Intermediate  90 63.30% 13.30% 7.78% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726584856 G -> DEL N N silent_mutation Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0726584856 G -> A LOC_Os07g44520.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0726584856 G -> A LOC_Os07g44499.1 downstream_gene_variant ; 4996.0bp to feature; MODIFIER silent_mutation Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0726584856 G -> A LOC_Os07g44530.1 downstream_gene_variant ; 1026.0bp to feature; MODIFIER silent_mutation Average:24.617; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726584856 NA 5.69E-06 mr1401 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 1.11E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 3.17E-06 6.70E-07 mr1708 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 1.92E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 2.12E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 7.31E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 4.72E-08 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 1.46E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 2.81E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 1.06E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 3.28E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726584856 NA 1.65E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251