\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726583792:

Variant ID: vg0726583792 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26583792
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCAACCAAGTGCTTCTGATCCAATCGGCCAGCCAGATTCTCGAAAGAGGAAGCTGGTTCTAAGTGACGACGAAGCCGATGATGCCGCCAGGAGGCCT[G/A]
GAGACCGAGAGACAACCAAGAAACTACCAAAACAGGCTACTCCAAGGAAGAAAACATCCAGTCGCCCTGTGCCAAAGATCAGGAAGTCTTCTAGGTGCAA

Reverse complement sequence

TTGCACCTAGAAGACTTCCTGATCTTTGGCACAGGGCGACTGGATGTTTTCTTCCTTGGAGTAGCCTGTTTTGGTAGTTTCTTGGTTGTCTCTCGGTCTC[C/T]
AGGCCTCCTGGCGGCATCATCGGCTTCGTCGTCACTTAGAACCAGCTTCCTCTTTCGAGAATCTGGCTGGCCGATTGGATCAGAAGCACTTGGTTGAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 40.50% 1.23% 3.28% NA
All Indica  2759 86.20% 10.00% 1.63% 2.21% NA
All Japonica  1512 1.30% 98.20% 0.20% 0.26% NA
Aus  269 60.60% 38.70% 0.00% 0.74% NA
Indica I  595 85.40% 14.30% 0.17% 0.17% NA
Indica II  465 95.90% 3.70% 0.22% 0.22% NA
Indica III  913 84.60% 6.50% 3.72% 5.26% NA
Indica Intermediate  786 83.00% 14.50% 1.15% 1.40% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 1.80% 97.40% 0.40% 0.40% NA
Japonica Intermediate  241 1.20% 97.50% 0.41% 0.83% NA
VI/Aromatic  96 11.50% 6.20% 4.17% 78.12% NA
Intermediate  90 31.10% 47.80% 6.67% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726583792 G -> DEL N N silent_mutation Average:20.918; most accessible tissue: Minghui63 root, score: 33.152 N N N N
vg0726583792 G -> A LOC_Os07g44499.1 downstream_gene_variant ; 3932.0bp to feature; MODIFIER silent_mutation Average:20.918; most accessible tissue: Minghui63 root, score: 33.152 N N N N
vg0726583792 G -> A LOC_Os07g44530.1 downstream_gene_variant ; 2090.0bp to feature; MODIFIER silent_mutation Average:20.918; most accessible tissue: Minghui63 root, score: 33.152 N N N N
vg0726583792 G -> A LOC_Os07g44520.1 intron_variant ; MODIFIER silent_mutation Average:20.918; most accessible tissue: Minghui63 root, score: 33.152 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726583792 NA 1.08E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792 NA 2.67E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792 1.13E-06 1.13E-06 mr1781 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792 NA 2.38E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792 NA 5.97E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792 NA 1.08E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251