Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726583792:

Variant ID: vg0726583792 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26583792
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AACTCAACCAAGTGCTTCTGATCCAATCGGCCAGCCAGATTCTCGAAAGAGGAAGCTGGTTCTAAGTGACGACGAAGCCGATGATGCCGCCAGGAGGCCT[G/A]
GAGACCGAGAGACAACCAAGAAACTACCAAAACAGGCTACTCCAAGGAAGAAAACATCCAGTCGCCCTGTGCCAAAGATCAGGAAGTCTTCTAGGTGCAA

Reverse complement sequence

TTGCACCTAGAAGACTTCCTGATCTTTGGCACAGGGCGACTGGATGTTTTCTTCCTTGGAGTAGCCTGTTTTGGTAGTTTCTTGGTTGTCTCTCGGTCTC[C/T]
AGGCCTCCTGGCGGCATCATCGGCTTCGTCGTCACTTAGAACCAGCTTCCTCTTTCGAGAATCTGGCTGGCCGATTGGATCAGAAGCACTTGGTTGAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	40.50%	1.23%	3.28%	NA
All Indica	2759	86.20%	10.00%	1.63%	2.21%	NA
All Japonica	1512	1.30%	98.20%	0.20%	0.26%	NA
Aus	269	60.60%	38.70%	0.00%	0.74%	NA
Indica I	595	85.40%	14.30%	0.17%	0.17%	NA
Indica II	465	95.90%	3.70%	0.22%	0.22%	NA
Indica III	913	84.60%	6.50%	3.72%	5.26%	NA
Indica Intermediate	786	83.00%	14.50%	1.15%	1.40%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	1.80%	97.40%	0.40%	0.40%	NA
Japonica Intermediate	241	1.20%	97.50%	0.41%	0.83%	NA
VI/Aromatic	96	11.50%	6.20%	4.17%	78.12%	NA
Intermediate	90	31.10%	47.80%	6.67%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726583792	G -> DEL	N	N	silent_mutation	Average:20.918; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0726583792	G -> A	LOC_Os07g44499.1	downstream_gene_variant ; 3932.0bp to feature; MODIFIER	silent_mutation	Average:20.918; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0726583792	G -> A	LOC_Os07g44530.1	downstream_gene_variant ; 2090.0bp to feature; MODIFIER	silent_mutation	Average:20.918; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N
vg0726583792	G -> A	LOC_Os07g44520.1	intron_variant ; MODIFIER	silent_mutation	Average:20.918; most accessible tissue: Minghui63 root, score: 33.152	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726583792	NA	1.08E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792	NA	2.67E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792	1.13E-06	1.13E-06	mr1781	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792	NA	2.38E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792	NA	5.97E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726583792	NA	1.08E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251