\
| Variant ID: vg0726583792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26583792 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 113. )
AACTCAACCAAGTGCTTCTGATCCAATCGGCCAGCCAGATTCTCGAAAGAGGAAGCTGGTTCTAAGTGACGACGAAGCCGATGATGCCGCCAGGAGGCCT[G/A]
GAGACCGAGAGACAACCAAGAAACTACCAAAACAGGCTACTCCAAGGAAGAAAACATCCAGTCGCCCTGTGCCAAAGATCAGGAAGTCTTCTAGGTGCAA
TTGCACCTAGAAGACTTCCTGATCTTTGGCACAGGGCGACTGGATGTTTTCTTCCTTGGAGTAGCCTGTTTTGGTAGTTTCTTGGTTGTCTCTCGGTCTC[C/T]
AGGCCTCCTGGCGGCATCATCGGCTTCGTCGTCACTTAGAACCAGCTTCCTCTTTCGAGAATCTGGCTGGCCGATTGGATCAGAAGCACTTGGTTGAGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.00% | 40.50% | 1.23% | 3.28% | NA |
| All Indica | 2759 | 86.20% | 10.00% | 1.63% | 2.21% | NA |
| All Japonica | 1512 | 1.30% | 98.20% | 0.20% | 0.26% | NA |
| Aus | 269 | 60.60% | 38.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 85.40% | 14.30% | 0.17% | 0.17% | NA |
| Indica II | 465 | 95.90% | 3.70% | 0.22% | 0.22% | NA |
| Indica III | 913 | 84.60% | 6.50% | 3.72% | 5.26% | NA |
| Indica Intermediate | 786 | 83.00% | 14.50% | 1.15% | 1.40% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.80% | 97.40% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.50% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 11.50% | 6.20% | 4.17% | 78.12% | NA |
| Intermediate | 90 | 31.10% | 47.80% | 6.67% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726583792 | G -> DEL | N | N | silent_mutation | Average:20.918; most accessible tissue: Minghui63 root, score: 33.152 | N | N | N | N |
| vg0726583792 | G -> A | LOC_Os07g44499.1 | downstream_gene_variant ; 3932.0bp to feature; MODIFIER | silent_mutation | Average:20.918; most accessible tissue: Minghui63 root, score: 33.152 | N | N | N | N |
| vg0726583792 | G -> A | LOC_Os07g44530.1 | downstream_gene_variant ; 2090.0bp to feature; MODIFIER | silent_mutation | Average:20.918; most accessible tissue: Minghui63 root, score: 33.152 | N | N | N | N |
| vg0726583792 | G -> A | LOC_Os07g44520.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.918; most accessible tissue: Minghui63 root, score: 33.152 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726583792 | NA | 1.08E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726583792 | NA | 2.67E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726583792 | 1.13E-06 | 1.13E-06 | mr1781 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726583792 | NA | 2.38E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726583792 | NA | 5.97E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726583792 | NA | 1.08E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |