Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726566560:

Variant ID: vg0726566560 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26566560
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGATAATTATTGTTCTAAATTAAGTTCACTGGCTCGGCTTGAGGCATGCATGTAAAGCGTCGTGATTAGTACTAGGACATGTTTAGAGGAGCTTCTAAC[T/C]
GCTGCAGCTTCTCTCAGAATTAGAAGCTCCCGAAACAGTCTAGCTTTTGGTTTAGATTCTAAGAAGCTGTAGTTGTAGAATCCAGCTAATGAACTACAAG

Reverse complement sequence

CTTGTAGTTCATTAGCTGGATTCTACAACTACAGCTTCTTAGAATCTAAACCAAAAGCTAGACTGTTTCGGGAGCTTCTAATTCTGAGAGAAGCTGCAGC[A/G]
GTTAGAAGCTCCTCTAAACATGTCCTAGTACTAATCACGACGCTTTACATGCATGCCTCAAGCCGAGCCAGTGAACTTAATTTAGAACAATAATTATCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.00%	15.40%	0.59%	0.00%	NA
All Indica	2759	94.90%	4.90%	0.25%	0.00%	NA
All Japonica	1512	60.40%	38.40%	1.26%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	92.60%	7.20%	0.17%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	97.80%	2.00%	0.22%	0.00%	NA
Indica Intermediate	786	91.00%	8.50%	0.51%	0.00%	NA
Temperate Japonica	767	93.70%	4.80%	1.43%	0.00%	NA
Tropical Japonica	504	15.30%	84.30%	0.40%	0.00%	NA
Japonica Intermediate	241	48.50%	49.00%	2.49%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	84.40%	13.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726566560	T -> C	LOC_Os07g44480.1	upstream_gene_variant ; 3200.0bp to feature; MODIFIER	silent_mutation	Average:51.172; most accessible tissue: Callus, score: 86.209	N	N	N	N
vg0726566560	T -> C	LOC_Os07g44499.1	upstream_gene_variant ; 695.0bp to feature; MODIFIER	silent_mutation	Average:51.172; most accessible tissue: Callus, score: 86.209	N	N	N	N
vg0726566560	T -> C	LOC_Os07g44480-LOC_Os07g44499	intergenic_region ; MODIFIER	silent_mutation	Average:51.172; most accessible tissue: Callus, score: 86.209	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726566560	1.28E-07	NA	mr1136	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	2.46E-06	mr1181	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	7.18E-06	7.18E-06	mr1419	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	3.41E-06	mr1426	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	1.03E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	7.75E-06	mr1708	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	1.01E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	3.35E-08	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	1.13E-06	mr1888	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	2.01E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	3.64E-07	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	1.00E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	4.84E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	2.31E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	1.09E-06	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	9.95E-06	mr1652_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	2.41E-07	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	4.55E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	8.25E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726566560	NA	1.73E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251