Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726559146:

Variant ID: vg0726559146 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26559146
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAATTACACACCATAAACACATACACACTCACAACGCACAACACACACTCACCCCCTATAAACGCACGCACGTAAATTCTACCCCTATAAGCATATT[T/C]
GAAGACTGTTGTCTCCGTGATGGGTTGGGCCAGGCCTTTAATGAAAGCCCGTCAAGAGCAGATCTGAGCCCACATAACTAATTATATGCCACAAATTCCT

Reverse complement sequence

AGGAATTTGTGGCATATAATTAGTTATGTGGGCTCAGATCTGCTCTTGACGGGCTTTCATTAAAGGCCTGGCCCAACCCATCACGGAGACAACAGTCTTC[A/G]
AATATGCTTATAGGGGTAGAATTTACGTGCGTGCGTTTATAGGGGGTGAGTGTGTGTTGTGCGTTGTGAGTGTGTATGTGTTTATGGTGTGTAATTTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 7.20% 0.06% 0.00% NA
All Indica  2759 95.80% 4.10% 0.07% 0.00% NA
All Japonica  1512 85.60% 14.40% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.80% 5.90% 0.34% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 92.50% 7.50% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 72.80% 27.20% 0.00% 0.00% NA
Japonica Intermediate  241 67.20% 32.40% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726559146 T -> C LOC_Os07g44460.1 upstream_gene_variant ; 812.0bp to feature; MODIFIER silent_mutation Average:72.263; most accessible tissue: Zhenshan97 root, score: 90.139 N N N N
vg0726559146 T -> C LOC_Os07g44470.1 upstream_gene_variant ; 1166.0bp to feature; MODIFIER silent_mutation Average:72.263; most accessible tissue: Zhenshan97 root, score: 90.139 N N N N
vg0726559146 T -> C LOC_Os07g44450.1 downstream_gene_variant ; 3533.0bp to feature; MODIFIER silent_mutation Average:72.263; most accessible tissue: Zhenshan97 root, score: 90.139 N N N N
vg0726559146 T -> C LOC_Os07g44480.1 downstream_gene_variant ; 2386.0bp to feature; MODIFIER silent_mutation Average:72.263; most accessible tissue: Zhenshan97 root, score: 90.139 N N N N
vg0726559146 T -> C LOC_Os07g44460-LOC_Os07g44470 intergenic_region ; MODIFIER silent_mutation Average:72.263; most accessible tissue: Zhenshan97 root, score: 90.139 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0726559146 T C 0.01 0.0 0.0 -0.01 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726559146 NA 1.79E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 1.01E-07 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 1.16E-07 5.43E-10 mr1159_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 7.20E-06 6.84E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 5.14E-06 5.13E-06 mr1192_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 8.80E-07 mr1267_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 2.63E-07 6.22E-09 mr1278_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 4.77E-06 1.41E-07 mr1284_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 1.88E-08 1.88E-08 mr1286_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 1.87E-06 1.87E-06 mr1311_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 1.69E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 5.90E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 1.56E-06 3.29E-07 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 8.48E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 2.91E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 1.92E-07 1.06E-08 mr1374_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 8.74E-06 8.80E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 1.74E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 1.24E-07 7.20E-08 mr1663_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 9.57E-07 1.95E-08 mr1665_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 6.05E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 5.70E-06 4.21E-07 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 4.31E-06 4.31E-06 mr1688_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 9.80E-06 9.80E-06 mr1697_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 6.02E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 4.42E-07 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 1.46E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 1.08E-06 1.08E-06 mr1822_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 3.65E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 4.27E-07 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 2.95E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 5.61E-07 5.60E-07 mr1847_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559146 NA 2.41E-06 mr1984_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251