\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726559137:

Variant ID: vg0726559137 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26559137
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTAAAAAAAATTACACACCATAAACACATACACACTCACAACGCACAACACACACTCACCCCCTATAAACGCACGCACGTAAATTCTACCCCTAT[A/G]
AGCATATTTGAAGACTGTTGTCTCCGTGATGGGTTGGGCCAGGCCTTTAATGAAAGCCCGTCAAGAGCAGATCTGAGCCCACATAACTAATTATATGCCA

Reverse complement sequence

TGGCATATAATTAGTTATGTGGGCTCAGATCTGCTCTTGACGGGCTTTCATTAAAGGCCTGGCCCAACCCATCACGGAGACAACAGTCTTCAAATATGCT[T/C]
ATAGGGGTAGAATTTACGTGCGTGCGTTTATAGGGGGTGAGTGTGTGTTGTGCGTTGTGAGTGTGTATGTGTTTATGGTGTGTAATTTTTTTTAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.30% 0.13% 0.00% NA
All Indica  2759 87.70% 12.10% 0.18% 0.00% NA
All Japonica  1512 79.40% 20.50% 0.07% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 93.40% 6.10% 0.50% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 78.40% 21.40% 0.22% 0.00% NA
Indica Intermediate  786 87.80% 12.20% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 60.10% 39.90% 0.00% 0.00% NA
Japonica Intermediate  241 56.00% 43.60% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726559137 A -> G LOC_Os07g44460.1 upstream_gene_variant ; 803.0bp to feature; MODIFIER silent_mutation Average:72.112; most accessible tissue: Zhenshan97 root, score: 90.081 N N N N
vg0726559137 A -> G LOC_Os07g44470.1 upstream_gene_variant ; 1175.0bp to feature; MODIFIER silent_mutation Average:72.112; most accessible tissue: Zhenshan97 root, score: 90.081 N N N N
vg0726559137 A -> G LOC_Os07g44450.1 downstream_gene_variant ; 3524.0bp to feature; MODIFIER silent_mutation Average:72.112; most accessible tissue: Zhenshan97 root, score: 90.081 N N N N
vg0726559137 A -> G LOC_Os07g44480.1 downstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:72.112; most accessible tissue: Zhenshan97 root, score: 90.081 N N N N
vg0726559137 A -> G LOC_Os07g44460-LOC_Os07g44470 intergenic_region ; MODIFIER silent_mutation Average:72.112; most accessible tissue: Zhenshan97 root, score: 90.081 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0726559137 A G 0.09 0.08 0.05 0.06 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726559137 4.80E-06 4.80E-06 mr1660 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 8.76E-10 mr1695 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 8.34E-06 NA mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 7.03E-06 1.87E-08 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 4.29E-06 4.29E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 4.23E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 1.36E-07 1.36E-07 mr1192_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 2.57E-06 mr1267_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 9.74E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 2.73E-06 6.46E-08 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 2.18E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 3.61E-06 3.61E-06 mr1286_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 4.45E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 9.93E-06 6.26E-07 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 1.81E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 1.80E-06 NA mr1645_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 3.55E-06 2.33E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 3.46E-06 mr1665_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 3.36E-06 3.35E-06 mr1697_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 1.53E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 4.40E-06 4.40E-06 mr1822_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 2.99E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 9.57E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 3.63E-06 3.62E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726559137 NA 1.12E-07 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251