\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726555808:

Variant ID: vg0726555808 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26555808
Reference Allele: TAlternative Allele: G,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TAGATCATCTAACCACTGGAAGTGACCTGGCTGCCAATCAAGAGTGGGCCCAGTACAGTGCATTTAACTAATGGGCTAAATGACGTCCTTCATGGGTATC[T/G,A]
TTTATGTGTTCTTTTGGCGTTAGGGTAGCATCGCGGTGAAGTCGAAGCTGCTGTGTCGTTTGGGTGGCAAGCTCGGCAACGATAACATGCGTGGGCTATT

Reverse complement sequence

AATAGCCCACGCATGTTATCGTTGCCGAGCTTGCCACCCAAACGACACAGCAGCTTCGACTTCACCGCGATGCTACCCTAACGCCAAAAGAACACATAAA[A/C,T]
GATACCCATGAAGGACGTCATTTAGCCCATTAGTTAAATGCACTGTACTGGGCCCACTCTTGATTGGCAGCCAGGTCACTTCCAGTGGTTAGATGATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 36.70% 0.28% 0.04% A: 0.02%
All Indica  2759 92.40% 7.40% 0.25% 0.00% A: 0.04%
All Japonica  1512 1.70% 98.10% 0.13% 0.07% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 85.50% 14.50% 0.00% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 97.60% 2.20% 0.11% 0.00% A: 0.11%
Indica Intermediate  786 88.80% 10.60% 0.64% 0.00% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 97.80% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 96.30% 0.41% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 53.30% 41.10% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726555808 T -> DEL N N silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> G LOC_Os07g44470.1 upstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> G LOC_Os07g44440.1 downstream_gene_variant ; 3148.0bp to feature; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> G LOC_Os07g44450.1 downstream_gene_variant ; 195.0bp to feature; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> G LOC_Os07g44460.1 downstream_gene_variant ; 1504.0bp to feature; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> G LOC_Os07g44450-LOC_Os07g44460 intergenic_region ; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> A LOC_Os07g44470.1 upstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> A LOC_Os07g44440.1 downstream_gene_variant ; 3148.0bp to feature; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> A LOC_Os07g44450.1 downstream_gene_variant ; 195.0bp to feature; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> A LOC_Os07g44460.1 downstream_gene_variant ; 1504.0bp to feature; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N
vg0726555808 T -> A LOC_Os07g44450-LOC_Os07g44460 intergenic_region ; MODIFIER silent_mutation Average:60.894; most accessible tissue: Callus, score: 89.024 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726555808 NA 8.32E-44 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 1.18E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 7.78E-07 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 5.93E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 5.45E-06 5.45E-06 mr1499 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 2.34E-06 mr1515 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 4.06E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 2.73E-07 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 4.87E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 1.94E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 6.86E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 2.64E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 1.64E-20 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 2.57E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 1.04E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 9.85E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 9.66E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 6.68E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 7.55E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 1.52E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 3.01E-19 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 4.73E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 3.65E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 3.48E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808 NA 1.10E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251