Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726555808:

Variant ID: vg0726555808 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26555808
Reference Allele: T	Alternative Allele: G,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

TAGATCATCTAACCACTGGAAGTGACCTGGCTGCCAATCAAGAGTGGGCCCAGTACAGTGCATTTAACTAATGGGCTAAATGACGTCCTTCATGGGTATC[T/G,A]
TTTATGTGTTCTTTTGGCGTTAGGGTAGCATCGCGGTGAAGTCGAAGCTGCTGTGTCGTTTGGGTGGCAAGCTCGGCAACGATAACATGCGTGGGCTATT

Reverse complement sequence

AATAGCCCACGCATGTTATCGTTGCCGAGCTTGCCACCCAAACGACACAGCAGCTTCGACTTCACCGCGATGCTACCCTAACGCCAAAAGAACACATAAA[A/C,T]
GATACCCATGAAGGACGTCATTTAGCCCATTAGTTAAATGCACTGTACTGGGCCCACTCTTGATTGGCAGCCAGGTCACTTCCAGTGGTTAGATGATCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.00%	36.70%	0.28%	0.04%	A: 0.02%
All Indica	2759	92.40%	7.40%	0.25%	0.00%	A: 0.04%
All Japonica	1512	1.70%	98.10%	0.13%	0.07%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	85.50%	14.50%	0.00%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	97.60%	2.20%	0.11%	0.00%	A: 0.11%
Indica Intermediate	786	88.80%	10.60%	0.64%	0.00%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	2.00%	97.80%	0.20%	0.00%	NA
Japonica Intermediate	241	2.90%	96.30%	0.41%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	53.30%	41.10%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726555808	T -> DEL	N	N	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> G	LOC_Os07g44470.1	upstream_gene_variant ; 4504.0bp to feature; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> G	LOC_Os07g44440.1	downstream_gene_variant ; 3148.0bp to feature; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> G	LOC_Os07g44450.1	downstream_gene_variant ; 195.0bp to feature; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> G	LOC_Os07g44460.1	downstream_gene_variant ; 1504.0bp to feature; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> G	LOC_Os07g44450-LOC_Os07g44460	intergenic_region ; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> A	LOC_Os07g44470.1	upstream_gene_variant ; 4504.0bp to feature; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> A	LOC_Os07g44440.1	downstream_gene_variant ; 3148.0bp to feature; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> A	LOC_Os07g44450.1	downstream_gene_variant ; 195.0bp to feature; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> A	LOC_Os07g44460.1	downstream_gene_variant ; 1504.0bp to feature; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N
vg0726555808	T -> A	LOC_Os07g44450-LOC_Os07g44460	intergenic_region ; MODIFIER	silent_mutation	Average:60.894; most accessible tissue: Callus, score: 89.024	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726555808	NA	8.32E-44	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	1.18E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	7.78E-07	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	5.93E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	5.45E-06	5.45E-06	mr1499	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	2.34E-06	mr1515	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	4.06E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	2.73E-07	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	4.87E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	1.94E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	6.86E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	2.64E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	1.64E-20	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	2.57E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	1.04E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	9.85E-16	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	9.66E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	6.68E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	7.55E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	1.52E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	3.01E-19	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	4.73E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	3.65E-19	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	3.48E-11	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726555808	NA	1.10E-11	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251