\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726548313:

Variant ID: vg0726548313 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26548313
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTCAGTGAAACCAGGCATCAATACTACCTCGGGATCTTTTTTTTGGACGGTTTTATATAGTTAAGGTATTCCGGTTAGGAGACCTCAGACAGATTTC[G/A]
TGTATAAATTGAGGGACGTCTGGTGAACTTAGGGCCTGTTCACTTTGATGCCATTTTCAATCTTACCAAATTTTGGTAAAGTTGTCAAAAAAAGTGGCTA

Reverse complement sequence

TAGCCACTTTTTTTGACAACTTTACCAAAATTTGGTAAGATTGAAAATGGCATCAAAGTGAACAGGCCCTAAGTTCACCAGACGTCCCTCAATTTATACA[C/T]
GAAATCTGTCTGAGGTCTCCTAACCGGAATACCTTAACTATATAAAACCGTCCAAAAAAAAGATCCCGAGGTAGTATTGATGCCTGGTTTCACTGACATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 4.30% 0.00% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 87.20% 12.80% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 75.70% 24.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726548313 G -> A LOC_Os07g44420.1 upstream_gene_variant ; 684.0bp to feature; MODIFIER silent_mutation Average:50.194; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0726548313 G -> A LOC_Os07g44430.1 upstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:50.194; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0726548313 G -> A LOC_Os07g44440.1 upstream_gene_variant ; 3468.0bp to feature; MODIFIER silent_mutation Average:50.194; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0726548313 G -> A LOC_Os07g44410.1 downstream_gene_variant ; 3130.0bp to feature; MODIFIER silent_mutation Average:50.194; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0726548313 G -> A LOC_Os07g44420-LOC_Os07g44430 intergenic_region ; MODIFIER silent_mutation Average:50.194; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726548313 3.41E-06 NA mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726548313 7.51E-07 NA mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726548313 NA 1.27E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251