Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726517533:

Variant ID: vg0726517533 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26517533
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACTTTGAGAGTCCATCCATGGTGGAAAAAACAAACAGGCTATAAAGGGCAAGAGATCCCATTTCCCGGGCTATGACCCGGGATGCCTAATTAATGTCTG[G/A]
TCCGCTTCTACTTATTGTATCGCTCTACCGTTTGCTCTTCAGCTTATTAGTAGCAACCAAAATTTTAATTTTAGAGTTAATTTTGAATTTTTTTATCAAG

Reverse complement sequence

CTTGATAAAAAAATTCAAAATTAACTCTAAAATTAAAATTTTGGTTGCTACTAATAAGCTGAAGAGCAAACGGTAGAGCGATACAATAAGTAGAAGCGGA[C/T]
CAGACATTAATTAGGCATCCCGGGTCATAGCCCGGGAAATGGGATCTCTTGCCCTTTATAGCCTGTTTGTTTTTTCCACCATGGATGGACTCTCAAAGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	14.30%	0.23%	19.38%	NA
All Indica	2759	66.30%	6.20%	0.29%	27.18%	NA
All Japonica	1512	74.10%	25.30%	0.00%	0.60%	NA
Aus	269	39.40%	4.50%	0.00%	56.13%	NA
Indica I	595	20.00%	11.90%	0.50%	67.56%	NA
Indica II	465	90.10%	0.90%	0.00%	9.03%	NA
Indica III	913	89.60%	2.20%	0.00%	8.21%	NA
Indica Intermediate	786	60.30%	9.70%	0.64%	29.39%	NA
Temperate Japonica	767	94.50%	4.40%	0.00%	1.04%	NA
Tropical Japonica	504	39.10%	60.90%	0.00%	0.00%	NA
Japonica Intermediate	241	82.60%	17.00%	0.00%	0.41%	NA
VI/Aromatic	96	10.40%	86.50%	3.12%	0.00%	NA
Intermediate	90	63.30%	30.00%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726517533	G -> DEL	N	N	silent_mutation	Average:43.886; most accessible tissue: Callus, score: 84.577	N	N	N	N
vg0726517533	G -> A	LOC_Os07g44380.1	upstream_gene_variant ; 2502.0bp to feature; MODIFIER	silent_mutation	Average:43.886; most accessible tissue: Callus, score: 84.577	N	N	N	N
vg0726517533	G -> A	LOC_Os07g44370.1	downstream_gene_variant ; 186.0bp to feature; MODIFIER	silent_mutation	Average:43.886; most accessible tissue: Callus, score: 84.577	N	N	N	N
vg0726517533	G -> A	LOC_Os07g44390.1	downstream_gene_variant ; 4403.0bp to feature; MODIFIER	silent_mutation	Average:43.886; most accessible tissue: Callus, score: 84.577	N	N	N	N
vg0726517533	G -> A	LOC_Os07g44370-LOC_Os07g44380	intergenic_region ; MODIFIER	silent_mutation	Average:43.886; most accessible tissue: Callus, score: 84.577	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726517533	NA	3.65E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	5.73E-06	mr1715	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	3.00E-12	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	6.30E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	5.20E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	4.66E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	1.79E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	2.12E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	7.28E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	2.92E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	4.73E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	2.10E-11	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	8.67E-06	4.08E-08	mr1830_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	1.95E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	3.63E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	1.83E-13	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533	NA	1.91E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251