\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726517533:

Variant ID: vg0726517533 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26517533
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTTTGAGAGTCCATCCATGGTGGAAAAAACAAACAGGCTATAAAGGGCAAGAGATCCCATTTCCCGGGCTATGACCCGGGATGCCTAATTAATGTCTG[G/A]
TCCGCTTCTACTTATTGTATCGCTCTACCGTTTGCTCTTCAGCTTATTAGTAGCAACCAAAATTTTAATTTTAGAGTTAATTTTGAATTTTTTTATCAAG

Reverse complement sequence

CTTGATAAAAAAATTCAAAATTAACTCTAAAATTAAAATTTTGGTTGCTACTAATAAGCTGAAGAGCAAACGGTAGAGCGATACAATAAGTAGAAGCGGA[C/T]
CAGACATTAATTAGGCATCCCGGGTCATAGCCCGGGAAATGGGATCTCTTGCCCTTTATAGCCTGTTTGTTTTTTCCACCATGGATGGACTCTCAAAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 14.30% 0.23% 19.38% NA
All Indica  2759 66.30% 6.20% 0.29% 27.18% NA
All Japonica  1512 74.10% 25.30% 0.00% 0.60% NA
Aus  269 39.40% 4.50% 0.00% 56.13% NA
Indica I  595 20.00% 11.90% 0.50% 67.56% NA
Indica II  465 90.10% 0.90% 0.00% 9.03% NA
Indica III  913 89.60% 2.20% 0.00% 8.21% NA
Indica Intermediate  786 60.30% 9.70% 0.64% 29.39% NA
Temperate Japonica  767 94.50% 4.40% 0.00% 1.04% NA
Tropical Japonica  504 39.10% 60.90% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 17.00% 0.00% 0.41% NA
VI/Aromatic  96 10.40% 86.50% 3.12% 0.00% NA
Intermediate  90 63.30% 30.00% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726517533 G -> DEL N N silent_mutation Average:43.886; most accessible tissue: Callus, score: 84.577 N N N N
vg0726517533 G -> A LOC_Os07g44380.1 upstream_gene_variant ; 2502.0bp to feature; MODIFIER silent_mutation Average:43.886; most accessible tissue: Callus, score: 84.577 N N N N
vg0726517533 G -> A LOC_Os07g44370.1 downstream_gene_variant ; 186.0bp to feature; MODIFIER silent_mutation Average:43.886; most accessible tissue: Callus, score: 84.577 N N N N
vg0726517533 G -> A LOC_Os07g44390.1 downstream_gene_variant ; 4403.0bp to feature; MODIFIER silent_mutation Average:43.886; most accessible tissue: Callus, score: 84.577 N N N N
vg0726517533 G -> A LOC_Os07g44370-LOC_Os07g44380 intergenic_region ; MODIFIER silent_mutation Average:43.886; most accessible tissue: Callus, score: 84.577 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726517533 NA 3.65E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 5.73E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 3.00E-12 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 6.30E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 5.20E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 4.66E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 1.79E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 2.12E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 7.28E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 2.92E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 4.73E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 2.10E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 8.67E-06 4.08E-08 mr1830_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 1.95E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 3.63E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 1.83E-13 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726517533 NA 1.91E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251