Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726459088:

Variant ID: vg0726459088 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26459088
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GCATAGCTGATATGTTGGGGAGGGGATGATTGACTTCTTGTGCAGGTTGACAGCAGTAGGTAGTCTGTTCATAGAAATTAACCAACCAAAAAATTTAACT[A/C]
TCGGAGGGGCTGAGCTCTTCCCCAGATGAATTCCTAGGGTGGCCAAAGTTGCTGACTTTCCATGGTTTTACAATAAGGGCTTAAGTTGATATCAGGCAAC

Reverse complement sequence

GTTGCCTGATATCAACTTAAGCCCTTATTGTAAAACCATGGAAAGTCAGCAACTTTGGCCACCCTAGGAATTCATCTGGGGAAGAGCTCAGCCCCTCCGA[T/G]
AGTTAAATTTTTTGGTTGGTTAATTTCTATGAACAGACTACCTACTGCTGTCAACCTGCACAAGAAGTCAATCATCCCCTCCCCAACATATCAGCTATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 19.10% 0.06% 0.00% NA
All Indica  2759 98.80% 1.10% 0.11% 0.00% NA
All Japonica  1512 44.40% 55.60% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.00% 1.50% 0.50% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 6.50% 93.50% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 56.00% 44.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726459088 A -> C LOC_Os07g44280.1 upstream_gene_variant ; 1467.0bp to feature; MODIFIER silent_mutation Average:60.666; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg0726459088 A -> C LOC_Os07g44280-LOC_Os07g44290 intergenic_region ; MODIFIER silent_mutation Average:60.666; most accessible tissue: Minghui63 root, score: 72.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726459088 2.21E-08 4.73E-20 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 5.66E-06 1.38E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 2.30E-06 NA mr1414 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 3.80E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 2.66E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 5.12E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 2.66E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 9.60E-16 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 2.27E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 8.66E-40 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 9.35E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 9.84E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 8.90E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 7.30E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 1.07E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 6.41E-06 5.31E-26 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 4.44E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 5.61E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 6.05E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 1.65E-16 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 5.63E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 1.55E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 3.62E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 1.72E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 2.48E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726459088 NA 8.61E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251