\
| Variant ID: vg0726458639 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26458639 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, G: 0.29, others allele: 0.00, population size: 236. )
AACATCAAAACTGTACAAACCATACAAGAAGAAAAGAGGAAGCATAACAGAGCGAAAGAAAAGACGAAAGAGAGAGAGAAAACAAACAAGAGAGATTACA[T/G]
AAGGTGGAGAGGAGAGGAGAAGGATGCAAGCCAAGACGGAAGAACCGCCTGGTCAGCCAGCTTGAAACGGTTTGCCCAAAGCTTGGCGTCGTTGACGCAG
CTGCGTCAACGACGCCAAGCTTTGGGCAAACCGTTTCAAGCTGGCTGACCAGGCGGTTCTTCCGTCTTGGCTTGCATCCTTCTCCTCTCCTCTCCACCTT[A/C]
TGTAATCTCTCTTGTTTGTTTTCTCTCTCTCTTTCGTCTTTTCTTTCGCTCTGTTATGCTTCCTCTTTTCTTCTTGTATGGTTTGTACAGTTTTGATGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.20% | 41.40% | 0.13% | 0.25% | NA |
| All Indica | 2759 | 42.80% | 56.90% | 0.18% | 0.14% | NA |
| All Japonica | 1512 | 98.90% | 0.90% | 0.00% | 0.26% | NA |
| Aus | 269 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 26.90% | 72.60% | 0.50% | 0.00% | NA |
| Indica II | 465 | 22.40% | 77.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 66.60% | 33.20% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 39.30% | 60.20% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 5.20% | 93.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 31.10% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726458639 | T -> DEL | N | N | silent_mutation | Average:58.53; most accessible tissue: Minghui63 root, score: 79.298 | N | N | N | N |
| vg0726458639 | T -> G | LOC_Os07g44280.1 | upstream_gene_variant ; 1018.0bp to feature; MODIFIER | silent_mutation | Average:58.53; most accessible tissue: Minghui63 root, score: 79.298 | N | N | N | N |
| vg0726458639 | T -> G | LOC_Os07g44280-LOC_Os07g44290 | intergenic_region ; MODIFIER | silent_mutation | Average:58.53; most accessible tissue: Minghui63 root, score: 79.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726458639 | NA | 5.54E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726458639 | NA | 8.51E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726458639 | NA | 3.88E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726458639 | NA | 1.00E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726458639 | NA | 1.62E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726458639 | NA | 1.24E-12 | mr1806 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726458639 | NA | 7.09E-06 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726458639 | NA | 8.93E-11 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |