Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726455758:

Variant ID: vg0726455758 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26455758
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTACTCATCCGATTTAGAATCCGATTACACCGATGTGTTCGTAATAATTAAATATTTATAACAAGATCTCACATGATTATATTTTGATGAAAAATCA[C/T]
AAATTACTTTTATGATATGTCTAAATTAATTTTAGATTTTACTAAGTTACTTCTTAGACATATAAAAGTAAATTCAGTAAAGGCTAAAAGTAATTTACAT

Reverse complement sequence

ATGTAAATTACTTTTAGCCTTTACTGAATTTACTTTTATATGTCTAAGAAGTAACTTAGTAAAATCTAAAATTAATTTAGACATATCATAAAAGTAATTT[G/A]
TGATTTTTCATCAAAATATAATCATGTGAGATCTTGTTATAAATATTTAATTATTACGAACACATCGGTGTAATCGGATTCTAAATCGGATGAGTAATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	8.30%	1.14%	0.00%	NA
All Indica	2759	84.10%	14.00%	1.92%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.60%	1.80%	0.50%	0.00%	NA
Indica II	465	93.10%	5.80%	1.08%	0.00%	NA
Indica III	913	68.60%	28.70%	2.74%	0.00%	NA
Indica Intermediate	786	86.60%	10.80%	2.54%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726455758	C -> T	LOC_Os07g44280.1	downstream_gene_variant ; 963.0bp to feature; MODIFIER	silent_mutation	Average:22.019; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0726455758	C -> T	LOC_Os07g44260-LOC_Os07g44280	intergenic_region ; MODIFIER	silent_mutation	Average:22.019; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726455758	NA	7.12E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	6.57E-06	NA	mr1082_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	NA	1.53E-06	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	NA	3.64E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	NA	5.59E-08	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	NA	1.32E-07	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	NA	5.04E-07	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	NA	6.94E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	NA	7.78E-07	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726455758	NA	1.68E-06	mr1896_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251