Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726451328:

Variant ID: vg0726451328 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26451328
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTGCTTGATTCTGACGCTGATAAATGTACTGCGGTCTGTGGATTATGTACCGTAAGGTTAGGTTAAGGCTGTGTTATACAGATACATATTTAAAGTAT[T/C]
AAACTTAGTCTAATAAAAAAACAAATTATAAAATCTACCTATAATCTGCGAGACGAATTTATTAAACCTAATTAATCTGTCATTAGCAAATGTTTACTGC

Reverse complement sequence

GCAGTAAACATTTGCTAATGACAGATTAATTAGGTTTAATAAATTCGTCTCGCAGATTATAGGTAGATTTTATAATTTGTTTTTTTATTAGACTAAGTTT[A/G]
ATACTTTAAATATGTATCTGTATAACACAGCCTTAACCTAACCTTACGGTACATAATCCACAGACCGCAGTACATTTATCAGCGTCAGAATCAAGCAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 13.40% 2.54% 0.00% NA
All Indica  2759 73.80% 22.30% 3.95% 0.00% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 95.90% 1.10% 2.97% 0.00% NA
Indica I  595 38.30% 50.60% 11.09% 0.00% NA
Indica II  465 88.20% 10.10% 1.72% 0.00% NA
Indica III  913 92.40% 7.40% 0.11% 0.00% NA
Indica Intermediate  786 70.40% 25.30% 4.33% 0.00% NA
Temperate Japonica  767 99.00% 0.90% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726451328 T -> C LOC_Os07g44250.1 upstream_gene_variant ; 4805.0bp to feature; MODIFIER silent_mutation Average:58.958; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0726451328 T -> C LOC_Os07g44260.1 upstream_gene_variant ; 858.0bp to feature; MODIFIER silent_mutation Average:58.958; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0726451328 T -> C LOC_Os07g44260-LOC_Os07g44280 intergenic_region ; MODIFIER silent_mutation Average:58.958; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726451328 NA 2.61E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0726451328 3.31E-06 NA mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 1.79E-06 8.66E-10 mr1065 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 NA 2.28E-10 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 NA 1.41E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 5.06E-06 NA mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 NA 4.18E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 NA 1.15E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 3.15E-06 1.22E-06 mr1762 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 2.01E-06 2.01E-06 mr1762 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726451328 NA 6.13E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251