\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726450998:

Variant ID: vg0726450998 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26450998
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAACATTTTTCACATTCATATTAATATTAATGAATCTAAATAGATATATATGTCTACATTTATTAACATCAAAATAAATGTGAAAAATGCTAGAATGA[T/C]
TTATATTGTGAAACGGATGGAGTAATATACACAGGCGTCCTTCTGAGTGGCAGATTAATCCGAGCTGGTTGTTAGGATAGAAAGAGGAAGTAAGACGAGC

Reverse complement sequence

GCTCGTCTTACTTCCTCTTTCTATCCTAACAACCAGCTCGGATTAATCTGCCACTCAGAAGGACGCCTGTGTATATTACTCCATCCGTTTCACAATATAA[A/G]
TCATTCTAGCATTTTTCACATTTATTTTGATGTTAATAAATGTAGACATATATATCTATTTAGATTCATTAATATTAATATGAATGTGAAAAATGTTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 28.10% 0.15% 0.00% NA
All Indica  2759 82.30% 17.40% 0.25% 0.00% NA
All Japonica  1512 46.20% 53.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.10% 4.20% 0.67% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 67.50% 32.30% 0.22% 0.00% NA
Indica Intermediate  786 84.90% 15.00% 0.13% 0.00% NA
Temperate Japonica  767 8.50% 91.50% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 60.20% 39.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726450998 T -> C LOC_Os07g44250.1 upstream_gene_variant ; 4475.0bp to feature; MODIFIER silent_mutation Average:59.112; most accessible tissue: Callus, score: 92.26 N N N N
vg0726450998 T -> C LOC_Os07g44260.1 upstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:59.112; most accessible tissue: Callus, score: 92.26 N N N N
vg0726450998 T -> C LOC_Os07g44260-LOC_Os07g44280 intergenic_region ; MODIFIER silent_mutation Average:59.112; most accessible tissue: Callus, score: 92.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726450998 NA 5.73E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 8.95E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 5.86E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 2.17E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 3.32E-06 3.32E-06 mr1853 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 5.23E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 2.39E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 1.30E-07 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 7.40E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 4.43E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 2.68E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 5.82E-07 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 1.85E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 5.60E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 4.02E-07 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 4.20E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 1.64E-08 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 4.40E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 6.14E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 1.47E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 2.31E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 7.19E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 4.10E-06 9.03E-10 mr1808_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 1.66E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726450998 NA 1.16E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251