\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726437652:

Variant ID: vg0726437652 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26437652
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAGCACAGTGATCGTCAGGTAGGCCACGATGGTTGCCCTTCCACGGCCGGGCTTGGTTATGAGATGTTTTAACTTTGATCAAAATTAAACTACTTCAA[A/G]
TTTAATTAAATTTATAGAAAAACTAATAATATTTTTTATTCAAGATAAATTTAAAAAATACATTTAATTTTTAATTTAATAAAACTAATCTGGTAATATA

Reverse complement sequence

TATATTACCAGATTAGTTTTATTAAATTAAAAATTAAATGTATTTTTTAAATTTATCTTGAATAAAAAATATTATTAGTTTTTCTATAAATTTAATTAAA[T/C]
TTGAAGTAGTTTAATTTTGATCAAAGTTAAAACATCTCATAACCAAGCCCGGCCGTGGAAGGGCAACCATCGTGGCCTACCTGACGATCACTGTGCTCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 19.20% 0.89% 2.98% NA
All Indica  2759 93.40% 1.20% 1.38% 4.10% NA
All Japonica  1512 44.10% 55.60% 0.13% 0.13% NA
Aus  269 86.60% 4.10% 0.74% 8.55% NA
Indica I  595 90.80% 0.80% 1.51% 6.89% NA
Indica II  465 94.60% 1.90% 0.22% 3.23% NA
Indica III  913 95.30% 0.40% 2.41% 1.86% NA
Indica Intermediate  786 92.40% 1.80% 0.76% 5.09% NA
Temperate Japonica  767 6.30% 93.20% 0.26% 0.26% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 25.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726437652 A -> DEL N N silent_mutation Average:75.002; most accessible tissue: Zhenshan97 young leaf, score: 90.456 N N N N
vg0726437652 A -> G LOC_Os07g44240.1 upstream_gene_variant ; 1606.0bp to feature; MODIFIER silent_mutation Average:75.002; most accessible tissue: Zhenshan97 young leaf, score: 90.456 N N N N
vg0726437652 A -> G LOC_Os07g44230.1 downstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:75.002; most accessible tissue: Zhenshan97 young leaf, score: 90.456 N N N N
vg0726437652 A -> G LOC_Os07g44230.2 downstream_gene_variant ; 2395.0bp to feature; MODIFIER silent_mutation Average:75.002; most accessible tissue: Zhenshan97 young leaf, score: 90.456 N N N N
vg0726437652 A -> G LOC_Os07g44230-LOC_Os07g44240 intergenic_region ; MODIFIER silent_mutation Average:75.002; most accessible tissue: Zhenshan97 young leaf, score: 90.456 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0726437652 A G -0.03 -0.05 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726437652 1.27E-08 2.27E-20 mr1304 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 5.66E-06 1.38E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 4.33E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 2.31E-06 NA mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 3.80E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 7.09E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 2.66E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 5.12E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 2.66E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 4.44E-15 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 1.63E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 2.27E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 2.45E-40 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 9.35E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 9.84E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 1.74E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 9.40E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 2.10E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 1.07E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 3.78E-06 2.74E-26 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 4.44E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 5.61E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 3.85E-21 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 7.06E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 5.63E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 4.81E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 1.55E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 6.89E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 1.72E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 1.61E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726437652 NA 8.61E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251