\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726435464:

Variant ID: vg0726435464 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26435464
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATAGTCAAATTTGTTTTTTTGTTGCGAGACGTAGAAATTGAATTTAAACTTGCATGTTTGTGGAGTGATATATCACATATTAATATATCTTCTCAA[A/T]
TTTTTTCATAACTATTTGAGTGACATGCAAACAATAAGGGAACATCCCCTCGAGGGATCAAAATCCACTCCCATGAGAAAGGGAATAATGCATGCATGCG

Reverse complement sequence

CGCATGCATGCATTATTCCCTTTCTCATGGGAGTGGATTTTGATCCCTCGAGGGGATGTTCCCTTATTGTTTGCATGTCACTCAAATAGTTATGAAAAAA[T/A]
TTGAGAAGATATATTAATATGTGATATATCACTCCACAAACATGCAAGTTTAAATTCAATTTCTACGTCTCGCAACAAAAAAACAAATTTGACTATAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 16.80% 1.54% 2.35% NA
All Indica  2759 93.70% 3.30% 0.47% 2.50% NA
All Japonica  1512 50.00% 44.30% 3.57% 2.12% NA
Aus  269 92.60% 4.10% 1.49% 1.86% NA
Indica I  595 88.60% 9.70% 0.67% 1.01% NA
Indica II  465 99.40% 0.20% 0.00% 0.43% NA
Indica III  913 93.30% 0.80% 0.55% 5.37% NA
Indica Intermediate  786 94.80% 3.20% 0.51% 1.53% NA
Temperate Japonica  767 84.40% 7.60% 5.74% 2.35% NA
Tropical Japonica  504 4.60% 94.20% 0.40% 0.79% NA
Japonica Intermediate  241 35.70% 56.80% 3.32% 4.15% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 72.20% 20.00% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726435464 A -> DEL N N silent_mutation Average:52.674; most accessible tissue: Callus, score: 79.194 N N N N
vg0726435464 A -> T LOC_Os07g44220.1 upstream_gene_variant ; 4186.0bp to feature; MODIFIER silent_mutation Average:52.674; most accessible tissue: Callus, score: 79.194 N N N N
vg0726435464 A -> T LOC_Os07g44240.1 upstream_gene_variant ; 3794.0bp to feature; MODIFIER silent_mutation Average:52.674; most accessible tissue: Callus, score: 79.194 N N N N
vg0726435464 A -> T LOC_Os07g44230.1 downstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:52.674; most accessible tissue: Callus, score: 79.194 N N N N
vg0726435464 A -> T LOC_Os07g44230.2 downstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:52.674; most accessible tissue: Callus, score: 79.194 N N N N
vg0726435464 A -> T LOC_Os07g44230-LOC_Os07g44240 intergenic_region ; MODIFIER silent_mutation Average:52.674; most accessible tissue: Callus, score: 79.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726435464 NA 4.89E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 3.01E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.19E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.95E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 2.56E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.07E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.94E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 8.96E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 6.88E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.70E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 2.43E-06 mr1320_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 8.97E-08 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 8.07E-07 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.81E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.14E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 3.02E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.07E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 3.12E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 8.00E-06 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 2.52E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 6.75E-09 mr1454_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 2.03E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.83E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 4.01E-06 NA mr1519_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 3.85E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 8.52E-15 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 1.82E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 2.91E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 5.86E-12 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 8.48E-18 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 7.16E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726435464 NA 5.64E-08 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251