Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726426716:

Variant ID: vg0726426716 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26426716
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TGCATCAATTATATAGAAATAAAAATGGATATTCCCTAAAATTGCAACTTTTGTATTTTATCCAAATATTATGTAAATGACTAAATGTATCATCGAATGA[A/G]
ATGTGCAAATACTTGGATTTGATCAAACCTTTTGCCCTTCATTTATTTTCCATCTTTAGAGTTTAGATTCAAATTCAATCTCTGTTATATGCGCTCGACA

Reverse complement sequence

TGTCGAGCGCATATAACAGAGATTGAATTTGAATCTAAACTCTAAAGATGGAAAATAAATGAAGGGCAAAAGGTTTGATCAAATCCAAGTATTTGCACAT[T/C]
TCATTCGATGATACATTTAGTCATTTACATAATATTTGGATAAAATACAAAAGTTGCAATTTTAGGGAATATCCATTTTTATTTCTATATAATTGATGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	38.80%	0.15%	0.19%	NA
All Indica	2759	92.70%	7.00%	0.11%	0.14%	NA
All Japonica	1512	1.30%	98.50%	0.07%	0.13%	NA
Aus	269	95.20%	4.80%	0.00%	0.00%	NA
Indica I	595	89.20%	10.80%	0.00%	0.00%	NA
Indica II	465	89.90%	10.10%	0.00%	0.00%	NA
Indica III	913	97.80%	2.00%	0.00%	0.22%	NA
Indica Intermediate	786	91.10%	8.30%	0.38%	0.25%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.20%	0.20%	0.00%	NA
Japonica Intermediate	241	1.70%	97.50%	0.00%	0.83%	NA
VI/Aromatic	96	9.40%	89.60%	1.04%	0.00%	NA
Intermediate	90	36.70%	57.80%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726426716	A -> DEL	N	N	silent_mutation	Average:32.289; most accessible tissue: Callus, score: 62.995	N	N	N	N
vg0726426716	A -> G	LOC_Os07g44220.1	downstream_gene_variant ; 4245.0bp to feature; MODIFIER	silent_mutation	Average:32.289; most accessible tissue: Callus, score: 62.995	N	N	N	N
vg0726426716	A -> G	LOC_Os07g44210.1	intron_variant ; MODIFIER	silent_mutation	Average:32.289; most accessible tissue: Callus, score: 62.995	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726426716	NA	1.83E-26	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	7.85E-12	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	3.47E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.38E-18	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	3.07E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.78E-14	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.10E-33	mr1414	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	2.07E-27	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	5.99E-12	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	8.48E-17	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.04E-28	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.07E-27	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	3.44E-33	mr1081_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	5.28E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.65E-15	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.02E-14	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	2.51E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.46E-19	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	4.57E-35	mr1256_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	9.21E-13	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	4.91E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	8.41E-27	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.25E-22	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	2.27E-34	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	1.69E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726426716	NA	2.10E-34	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251