\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726380549:

Variant ID: vg0726380549 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 26380549
Reference Allele: GAlternative Allele: A,GT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACTTTAAATCCTTTCAAATACAAATGTTATAAACTACAAAGTGGTAGATCCCATTGAGCTCTACAACTTTGATATGGAACACATCTCCATCAGATGTC[G/A,GT]
TTGAATTGTAGATCTGAGATTTTATAAAAATTAATATGGTATATTATAATGAATATTTAGACCTATAAATGACCTCAAATAATAAAATAGTCAATAATAA

Reverse complement sequence

TTATTATTGACTATTTTATTATTTGAGGTCATTTATAGGTCTAAATATTCATTATAATATACCATATTAATTTTTATAAAATCTCAGATCTACAATTCAA[C/T,AC]
GACATCTGATGGAGATGTGTTCCATATCAAAGTTGTAGAGCTCAATGGGATCTACCACTTTGTAGTTTATAACATTTGTATTTGAAAGGATTTAAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 16.30% 0.11% 0.28% NA
All Indica  2759 96.60% 3.20% 0.00% 0.18% NA
All Japonica  1512 56.30% 43.30% 0.20% 0.20% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 91.60% 8.40% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.00% 0.90% 0.00% 0.11% NA
Indica Intermediate  786 95.80% 3.70% 0.00% 0.51% NA
Temperate Japonica  767 91.80% 8.20% 0.00% 0.00% NA
Tropical Japonica  504 8.50% 91.10% 0.20% 0.20% NA
Japonica Intermediate  241 43.20% 55.20% 0.83% 0.83% NA
VI/Aromatic  96 89.60% 8.30% 1.04% 1.04% NA
Intermediate  90 75.60% 18.90% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726380549 G -> DEL N N silent_mutation Average:25.253; most accessible tissue: Callus, score: 38.583 N N N N
vg0726380549 G -> GT LOC_Os07g44140.1 upstream_gene_variant ; 2031.0bp to feature; MODIFIER N Average:25.253; most accessible tissue: Callus, score: 38.583 N N N N
vg0726380549 G -> GT LOC_Os07g44130.1 downstream_gene_variant ; 2910.0bp to feature; MODIFIER N Average:25.253; most accessible tissue: Callus, score: 38.583 N N N N
vg0726380549 G -> GT LOC_Os07g44130-LOC_Os07g44140 intergenic_region ; MODIFIER N Average:25.253; most accessible tissue: Callus, score: 38.583 N N N N
vg0726380549 G -> A LOC_Os07g44140.1 upstream_gene_variant ; 2032.0bp to feature; MODIFIER silent_mutation Average:25.253; most accessible tissue: Callus, score: 38.583 N N N N
vg0726380549 G -> A LOC_Os07g44130.1 downstream_gene_variant ; 2909.0bp to feature; MODIFIER silent_mutation Average:25.253; most accessible tissue: Callus, score: 38.583 N N N N
vg0726380549 G -> A LOC_Os07g44130-LOC_Os07g44140 intergenic_region ; MODIFIER silent_mutation Average:25.253; most accessible tissue: Callus, score: 38.583 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726380549 NA 2.44E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.84E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 8.33E-07 NA mr1092_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 8.82E-07 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 3.52E-16 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.24E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 4.35E-06 1.37E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 2.77E-06 NA mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.55E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 3.67E-07 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 3.03E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 9.73E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 4.56E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.90E-08 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 9.31E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 6.38E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 2.72E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 4.19E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.37E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 5.82E-07 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 2.27E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 4.41E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 2.06E-07 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.62E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 7.75E-08 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 3.83E-07 mr1428_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 8.01E-06 mr1440_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 2.16E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 5.93E-06 mr1466_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 3.72E-07 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 4.12E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 7.99E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 7.26E-07 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 7.04E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 8.30E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 3.02E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 3.54E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.69E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 2.51E-06 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 9.88E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 8.90E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.41E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 3.00E-11 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 8.75E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 5.56E-18 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 4.02E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726380549 NA 1.34E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251