\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726378569:

Variant ID: vg0726378569 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26378569
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGCTTGTCTAAAATCTCGCGTTCCTCCAGTTGACTGAACGAATCACATGCGTAAGATATTAAAGTCAGGTTACAAGGAAAGGGAGGCAATGTTTAAGG[G/A]
TGTGTTTAGTTCACGCTAAAATTAGAAATTTGGTTAAAATTGTACGATGTAACGGAAAAGTTAGAAGTTTGTGTGTGTAGGAAAGTTTTGATGTGATGAA

Reverse complement sequence

TTCATCACATCAAAACTTTCCTACACACACAAACTTCTAACTTTTCCGTTACATCGTACAATTTTAACCAAATTTCTAATTTTAGCGTGAACTAAACACA[C/T]
CCTTAAACATTGCCTCCCTTTCCTTGTAACCTGACTTTAATATCTTACGCATGTGATTCGTTCAGTCAACTGGAGGAACGCGAGATTTTAGACAAGCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.30% 0.28% 0.00% NA
All Indica  2759 98.10% 1.70% 0.18% 0.00% NA
All Japonica  1512 80.40% 19.20% 0.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.00% 3.40% 0.67% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 45.00% 53.60% 1.39% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726378569 G -> A LOC_Os07g44140.1 upstream_gene_variant ; 4012.0bp to feature; MODIFIER silent_mutation Average:32.413; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0726378569 G -> A LOC_Os07g44130.1 downstream_gene_variant ; 929.0bp to feature; MODIFIER silent_mutation Average:32.413; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N
vg0726378569 G -> A LOC_Os07g44130-LOC_Os07g44140 intergenic_region ; MODIFIER silent_mutation Average:32.413; most accessible tissue: Zhenshan97 root, score: 56.557 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726378569 NA 3.54E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 1.09E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 2.35E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 1.36E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 6.69E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 6.15E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 4.21E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 7.14E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 5.54E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 5.85E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 4.46E-07 NA mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 1.99E-06 9.95E-10 mr1671_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726378569 NA 6.05E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251