\
| Variant ID: vg0726378569 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26378569 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTGCTTGTCTAAAATCTCGCGTTCCTCCAGTTGACTGAACGAATCACATGCGTAAGATATTAAAGTCAGGTTACAAGGAAAGGGAGGCAATGTTTAAGG[G/A]
TGTGTTTAGTTCACGCTAAAATTAGAAATTTGGTTAAAATTGTACGATGTAACGGAAAAGTTAGAAGTTTGTGTGTGTAGGAAAGTTTTGATGTGATGAA
TTCATCACATCAAAACTTTCCTACACACACAAACTTCTAACTTTTCCGTTACATCGTACAATTTTAACCAAATTTCTAATTTTAGCGTGAACTAAACACA[C/T]
CCTTAAACATTGCCTCCCTTTCCTTGTAACCTGACTTTAATATCTTACGCATGTGATTCGTTCAGTCAACTGGAGGAACGCGAGATTTTAGACAAGCACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 7.30% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 98.10% | 1.70% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 80.40% | 19.20% | 0.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 3.40% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 45.00% | 53.60% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726378569 | G -> A | LOC_Os07g44140.1 | upstream_gene_variant ; 4012.0bp to feature; MODIFIER | silent_mutation | Average:32.413; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg0726378569 | G -> A | LOC_Os07g44130.1 | downstream_gene_variant ; 929.0bp to feature; MODIFIER | silent_mutation | Average:32.413; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| vg0726378569 | G -> A | LOC_Os07g44130-LOC_Os07g44140 | intergenic_region ; MODIFIER | silent_mutation | Average:32.413; most accessible tissue: Zhenshan97 root, score: 56.557 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726378569 | NA | 3.54E-11 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 1.09E-11 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 2.35E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 1.36E-10 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 6.69E-12 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 6.15E-12 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 4.21E-07 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 7.14E-14 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 5.54E-13 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 5.85E-14 | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | 4.46E-07 | NA | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | 1.99E-06 | 9.95E-10 | mr1671_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726378569 | NA | 6.05E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |