\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726354661:

Variant ID: vg0726354661 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 26354661
Reference Allele: GAlternative Allele: A,GA
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGGCTAGCAATTAATTATTACATGTAATTAATTGTTAATTAATTAATTAATTAATTAATTGATGGTGAGAAGATGAGACCGATAATTAAACCATGTTG[G/A,GA]
TCGGTTGCTTGCGTTCCAATTAAATCACTGGTCGAGAATGAAGTGATGCTAAAGCAAAGCGAATGTGTGTGTACAAAGTCCAACAGGGGCATGCATCCAT

Reverse complement sequence

ATGGATGCATGCCCCTGTTGGACTTTGTACACACACATTCGCTTTGCTTTAGCATCACTTCATTCTCGACCAGTGATTTAATTGGAACGCAAGCAACCGA[C/T,TC]
CAACATGGTTTAATTATCGGTCTCATCTTCTCACCATCAATTAATTAATTAATTAATTAATTAACAATTAATTACATGTAATAATTAATTGCTAGCCAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.70% 0.00% 0.00% GA: 0.11%
All Indica  2759 95.50% 4.50% 0.00% 0.00% NA
All Japonica  1512 3.30% 96.60% 0.00% 0.00% GA: 0.07%
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 89.90% 10.10% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 92.90% 0.00% 0.00% GA: 0.41%
VI/Aromatic  96 86.50% 9.40% 0.00% 0.00% GA: 4.17%
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726354661 G -> GA LOC_Os07g44090.3 upstream_gene_variant ; 1227.0bp to feature; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> GA LOC_Os07g44090.1 upstream_gene_variant ; 1172.0bp to feature; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> GA LOC_Os07g44090.2 upstream_gene_variant ; 1227.0bp to feature; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> GA LOC_Os07g44080.1 downstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> GA LOC_Os07g44080-LOC_Os07g44090 intergenic_region ; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> A LOC_Os07g44090.3 upstream_gene_variant ; 1228.0bp to feature; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> A LOC_Os07g44090.1 upstream_gene_variant ; 1173.0bp to feature; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> A LOC_Os07g44090.2 upstream_gene_variant ; 1228.0bp to feature; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> A LOC_Os07g44080.1 downstream_gene_variant ; 4435.0bp to feature; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N
vg0726354661 G -> A LOC_Os07g44080-LOC_Os07g44090 intergenic_region ; MODIFIER silent_mutation Average:73.929; most accessible tissue: Callus, score: 91.525 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726354661 NA 5.06E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 5.14E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.21E-15 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 7.25E-40 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.12E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 3.17E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 5.54E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.01E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.26E-52 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.09E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.16E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.03E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.89E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 3.70E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.59E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.33E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.82E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 3.96E-55 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 5.48E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.57E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.70E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.38E-57 mr1480_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.48E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.02E-43 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 6.92E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.27E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 6.44E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 5.08E-14 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 4.29E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 3.55E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 9.73E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 9.07E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.15E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 4.88E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 3.50E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 3.47E-19 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 3.48E-18 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 9.50E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 7.04E-17 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.54E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.38E-15 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.03E-17 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.96E-33 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.09E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.69E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.41E-81 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 2.56E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 1.06E-23 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726354661 NA 3.96E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251