\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726312270:

Variant ID: vg0726312270 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26312270
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTCAGTAAAATAAAGGTCGTGGGAACAAATTCTTTCATATATGTGTGTGATGTGATTTTTTTCTTCCTCCATAGAACAAATCTTGTAATAGATCTAA[C/G]
GATTCAAAATTACGTGAAACTTACATACAAGTTACACTGTAGTTACATGCAAGTTACAGTGTAATTACATACAAGTTACATTGTAATTACACTACGATTG

Reverse complement sequence

CAATCGTAGTGTAATTACAATGTAACTTGTATGTAATTACACTGTAACTTGCATGTAACTACAGTGTAACTTGTATGTAAGTTTCACGTAATTTTGAATC[G/C]
TTAGATCTATTACAAGATTTGTTCTATGGAGGAAGAAAAAAATCACATCACACACATATATGAAAGAATTTGTTCCCACGACCTTTATTTTACTGAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.60% 16.60% 1.74% 64.01% NA
All Indica  2759 1.40% 1.30% 2.07% 95.22% NA
All Japonica  1512 48.80% 48.30% 1.39% 1.52% NA
Aus  269 8.90% 0.00% 0.37% 90.71% NA
Indica I  595 3.00% 1.30% 5.21% 90.42% NA
Indica II  465 0.20% 2.60% 0.65% 96.56% NA
Indica III  913 0.50% 0.10% 1.42% 97.92% NA
Indica Intermediate  786 1.90% 1.90% 1.27% 94.91% NA
Temperate Japonica  767 13.60% 82.80% 2.48% 1.17% NA
Tropical Japonica  504 93.10% 5.00% 0.00% 1.98% NA
Japonica Intermediate  241 68.50% 29.00% 0.83% 1.66% NA
VI/Aromatic  96 8.30% 1.00% 1.04% 89.58% NA
Intermediate  90 26.70% 21.10% 2.22% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726312270 C -> DEL N N silent_mutation Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 N N N N
vg0726312270 C -> G LOC_Os07g44020.1 upstream_gene_variant ; 584.0bp to feature; MODIFIER silent_mutation Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 N N N N
vg0726312270 C -> G LOC_Os07g44010.1 downstream_gene_variant ; 3740.0bp to feature; MODIFIER silent_mutation Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 N N N N
vg0726312270 C -> G LOC_Os07g44030.1 downstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 N N N N
vg0726312270 C -> G LOC_Os07g44020-LOC_Os07g44030 intergenic_region ; MODIFIER silent_mutation Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726312270 NA 2.44E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 1.02E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 5.49E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 1.44E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 3.42E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 5.43E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 4.54E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 2.81E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 4.11E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 9.58E-13 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 8.33E-09 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 1.08E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 3.74E-06 mr1397_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 9.24E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 1.11E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 7.32E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 1.36E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 7.99E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 2.66E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 3.54E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 6.05E-14 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 3.97E-12 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 1.87E-16 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 4.77E-11 mr1966_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 1.49E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726312270 NA 8.34E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251