\
| Variant ID: vg0726312270 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26312270 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, G: 0.01, others allele: 0.00, population size: 90. )
TATTTCAGTAAAATAAAGGTCGTGGGAACAAATTCTTTCATATATGTGTGTGATGTGATTTTTTTCTTCCTCCATAGAACAAATCTTGTAATAGATCTAA[C/G]
GATTCAAAATTACGTGAAACTTACATACAAGTTACACTGTAGTTACATGCAAGTTACAGTGTAATTACATACAAGTTACATTGTAATTACACTACGATTG
CAATCGTAGTGTAATTACAATGTAACTTGTATGTAATTACACTGTAACTTGCATGTAACTACAGTGTAACTTGTATGTAAGTTTCACGTAATTTTGAATC[G/C]
TTAGATCTATTACAAGATTTGTTCTATGGAGGAAGAAAAAAATCACATCACACACATATATGAAAGAATTTGTTCCCACGACCTTTATTTTACTGAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 17.60% | 16.60% | 1.74% | 64.01% | NA |
| All Indica | 2759 | 1.40% | 1.30% | 2.07% | 95.22% | NA |
| All Japonica | 1512 | 48.80% | 48.30% | 1.39% | 1.52% | NA |
| Aus | 269 | 8.90% | 0.00% | 0.37% | 90.71% | NA |
| Indica I | 595 | 3.00% | 1.30% | 5.21% | 90.42% | NA |
| Indica II | 465 | 0.20% | 2.60% | 0.65% | 96.56% | NA |
| Indica III | 913 | 0.50% | 0.10% | 1.42% | 97.92% | NA |
| Indica Intermediate | 786 | 1.90% | 1.90% | 1.27% | 94.91% | NA |
| Temperate Japonica | 767 | 13.60% | 82.80% | 2.48% | 1.17% | NA |
| Tropical Japonica | 504 | 93.10% | 5.00% | 0.00% | 1.98% | NA |
| Japonica Intermediate | 241 | 68.50% | 29.00% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 8.30% | 1.00% | 1.04% | 89.58% | NA |
| Intermediate | 90 | 26.70% | 21.10% | 2.22% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726312270 | C -> DEL | N | N | silent_mutation | Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 | N | N | N | N |
| vg0726312270 | C -> G | LOC_Os07g44020.1 | upstream_gene_variant ; 584.0bp to feature; MODIFIER | silent_mutation | Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 | N | N | N | N |
| vg0726312270 | C -> G | LOC_Os07g44010.1 | downstream_gene_variant ; 3740.0bp to feature; MODIFIER | silent_mutation | Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 | N | N | N | N |
| vg0726312270 | C -> G | LOC_Os07g44030.1 | downstream_gene_variant ; 924.0bp to feature; MODIFIER | silent_mutation | Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 | N | N | N | N |
| vg0726312270 | C -> G | LOC_Os07g44020-LOC_Os07g44030 | intergenic_region ; MODIFIER | silent_mutation | Average:17.49; most accessible tissue: Minghui63 root, score: 46.493 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726312270 | NA | 2.44E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 1.02E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 5.49E-10 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 1.44E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 3.42E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 5.43E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 4.54E-09 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 2.81E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 4.11E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 9.58E-13 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 8.33E-09 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 1.08E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 3.74E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 9.24E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 1.11E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 7.32E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 1.36E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 7.99E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 2.66E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 3.54E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 6.05E-14 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 3.97E-12 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 1.87E-16 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 4.77E-11 | mr1966_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 1.49E-06 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726312270 | NA | 8.34E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |