\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726300919:

Variant ID: vg0726300919 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26300919
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACGGAACGATAGTCCCAAACTATTGAAACCGGTATAATTTGACTCCCTTAATGGTTTTGGAGTACGGTTTCGCTGACGTGACGCTTATGTGCTGATG[T/C]
TGACCTGGTCTTCCCCTCTCTCCCTTATCTATCTCCCTCTCTTCCTCTTTGACTTTCTATGGGTAACGGGGGTCGGGGCAGCAGGCGGGGCAGGGAAGGT

Reverse complement sequence

ACCTTCCCTGCCCCGCCTGCTGCCCCGACCCCCGTTACCCATAGAAAGTCAAAGAGGAAGAGAGGGAGATAGATAAGGGAGAGAGGGGAAGACCAGGTCA[A/G]
CATCAGCACATAAGCGTCACGTCAGCGAAACCGTACTCCAAAACCATTAAGGGAGTCAAATTATACCGGTTTCAATAGTTTGGGACTATCGTTCCGTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 35.20% 0.15% 0.17% NA
All Indica  2759 95.10% 4.70% 0.14% 0.11% NA
All Japonica  1512 2.80% 97.00% 0.13% 0.07% NA
Aus  269 91.10% 8.20% 0.00% 0.74% NA
Indica I  595 94.80% 4.50% 0.50% 0.17% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 96.20% 3.60% 0.00% 0.22% NA
Indica Intermediate  786 92.70% 7.10% 0.13% 0.00% NA
Temperate Japonica  767 3.50% 96.20% 0.26% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.00% 0.41% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 52.20% 44.40% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726300919 T -> DEL N N silent_mutation Average:95.731; most accessible tissue: Minghui63 panicle, score: 97.381 N N N N
vg0726300919 T -> C LOC_Os07g43980.1 upstream_gene_variant ; 4764.0bp to feature; MODIFIER silent_mutation Average:95.731; most accessible tissue: Minghui63 panicle, score: 97.381 N N N N
vg0726300919 T -> C LOC_Os07g43990.1 upstream_gene_variant ; 292.0bp to feature; MODIFIER silent_mutation Average:95.731; most accessible tissue: Minghui63 panicle, score: 97.381 N N N N
vg0726300919 T -> C LOC_Os07g44000.1 upstream_gene_variant ; 428.0bp to feature; MODIFIER silent_mutation Average:95.731; most accessible tissue: Minghui63 panicle, score: 97.381 N N N N
vg0726300919 T -> C LOC_Os07g44004.1 upstream_gene_variant ; 1539.0bp to feature; MODIFIER silent_mutation Average:95.731; most accessible tissue: Minghui63 panicle, score: 97.381 N N N N
vg0726300919 T -> C LOC_Os07g43990-LOC_Os07g44000 intergenic_region ; MODIFIER silent_mutation Average:95.731; most accessible tissue: Minghui63 panicle, score: 97.381 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0726300919 T C 0.0 -0.02 -0.01 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726300919 NA 2.98E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0726300919 NA 5.08E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 2.79E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 2.39E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 1.78E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 4.95E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 3.64E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 6.75E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 4.05E-07 NA mr1510_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 1.85E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 1.80E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 6.97E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 7.41E-06 mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 1.24E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 3.94E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 5.77E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 3.52E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 4.44E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 1.00E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 1.80E-23 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726300919 NA 6.04E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251