\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726269098:

Variant ID: vg0726269098 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26269098
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.40, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TCAATGATAATGAGTAAAACGAGTTGTGAATTATAGGACTGCGGCGGCAGCACCACAGCAACAACAACAATAATCCTCTCTCCCTTTCACTAGCATCGTC[T/C]
ACTTTCATTAACATCTATGTGAATGTGGACAATACTAAAAAGTCTTATATCATAAAACGGAGGATAGCATACAATGGTACTCCCGCACTTGGAGATGGTT

Reverse complement sequence

AACCATCTCCAAGTGCGGGAGTACCATTGTATGCTATCCTCCGTTTTATGATATAAGACTTTTTAGTATTGTCCACATTCACATAGATGTTAATGAAAGT[A/G]
GACGATGCTAGTGAAAGGGAGAGAGGATTATTGTTGTTGTTGCTGTGGTGCTGCCGCCGCAGTCCTATAATTCACAACTCGTTTTACTCATTATCATTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.00% 30.10% 3.28% 28.65% NA
All Indica  2759 4.00% 50.50% 2.65% 42.81% NA
All Japonica  1512 97.90% 0.50% 0.60% 1.06% NA
Aus  269 20.40% 0.40% 26.02% 53.16% NA
Indica I  595 6.10% 22.70% 2.35% 68.91% NA
Indica II  465 3.70% 69.90% 1.51% 24.95% NA
Indica III  913 1.00% 65.40% 2.63% 31.00% NA
Indica Intermediate  786 6.20% 42.90% 3.56% 47.33% NA
Temperate Japonica  767 97.10% 0.80% 1.04% 1.04% NA
Tropical Japonica  504 98.60% 0.00% 0.20% 1.19% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 94.80% 4.20% 0.00% 1.04% NA
Intermediate  90 63.30% 18.90% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726269098 T -> DEL N N silent_mutation Average:51.392; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N
vg0726269098 T -> C LOC_Os07g43960.1 upstream_gene_variant ; 2105.0bp to feature; MODIFIER silent_mutation Average:51.392; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N
vg0726269098 T -> C LOC_Os07g43960.2 upstream_gene_variant ; 2105.0bp to feature; MODIFIER silent_mutation Average:51.392; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N
vg0726269098 T -> C LOC_Os07g43950.1 downstream_gene_variant ; 425.0bp to feature; MODIFIER silent_mutation Average:51.392; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N
vg0726269098 T -> C LOC_Os07g43950-LOC_Os07g43960 intergenic_region ; MODIFIER silent_mutation Average:51.392; most accessible tissue: Minghui63 young leaf, score: 92.158 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0726269098 T C 0.04 0.1 0.06 -0.01 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726269098 NA 1.08E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 6.37E-33 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 3.80E-64 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 4.26E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 2.08E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.92E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.16E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.05E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 2.00E-36 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.24E-24 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 6.05E-77 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.23E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 2.22E-30 mr1323_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 2.89E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 8.72E-15 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.42E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 3.64E-20 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.01E-50 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 9.19E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.02E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 3.73E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 1.96E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726269098 NA 7.56E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251