| Variant ID: vg0726230011 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26230011 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 101. )
TTTTTGTTCTCATGACCGTAACGCATCGTCGCCTACTATTCGTTTTTTTCGTCTCCTTTTTTTTTGATTCGTTTTGTCGTGTTTTTTTGCTGTTTTTATC[C/T]
GGTTTCTTTTTCTTCATTGTTTGTTTTTTCCCGATTCGGTTTTTTTGCTAGGTCTCTTTTTCGCTTTTTTCACCCGGTTTTTTATCTCATCCGATCTGTT
AACAGATCGGATGAGATAAAAAACCGGGTGAAAAAAGCGAAAAAGAGACCTAGCAAAAAAACCGAATCGGGAAAAAACAAACAATGAAGAAAAAGAAACC[G/A]
GATAAAAACAGCAAAAAAACACGACAAAACGAATCAAAAAAAAAGGAGACGAAAAAAACGAATAGTAGGCGACGATGCGTTACGGTCATGAGAACAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 41.20% | 1.82% | 0.40% | NA |
| All Indica | 2759 | 90.20% | 6.10% | 3.04% | 0.65% | NA |
| All Japonica | 1512 | 1.30% | 98.60% | 0.00% | 0.07% | NA |
| Aus | 269 | 48.70% | 51.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.90% | 10.30% | 3.03% | 0.84% | NA |
| Indica II | 465 | 94.00% | 4.10% | 1.72% | 0.22% | NA |
| Indica III | 913 | 93.60% | 1.30% | 4.27% | 0.77% | NA |
| Indica Intermediate | 786 | 87.30% | 9.70% | 2.42% | 0.64% | NA |
| Temperate Japonica | 767 | 1.20% | 98.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 63.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726230011 | C -> DEL | N | N | silent_mutation | Average:31.194; most accessible tissue: Callus, score: 59.223 | N | N | N | N |
| vg0726230011 | C -> T | LOC_Os07g43850.1 | upstream_gene_variant ; 4588.0bp to feature; MODIFIER | silent_mutation | Average:31.194; most accessible tissue: Callus, score: 59.223 | N | N | N | N |
| vg0726230011 | C -> T | LOC_Os07g43870.1 | upstream_gene_variant ; 660.0bp to feature; MODIFIER | silent_mutation | Average:31.194; most accessible tissue: Callus, score: 59.223 | N | N | N | N |
| vg0726230011 | C -> T | LOC_Os07g43870.2 | upstream_gene_variant ; 668.0bp to feature; MODIFIER | silent_mutation | Average:31.194; most accessible tissue: Callus, score: 59.223 | N | N | N | N |
| vg0726230011 | C -> T | LOC_Os07g43870.3 | upstream_gene_variant ; 668.0bp to feature; MODIFIER | silent_mutation | Average:31.194; most accessible tissue: Callus, score: 59.223 | N | N | N | N |
| vg0726230011 | C -> T | LOC_Os07g43860.1 | downstream_gene_variant ; 3470.0bp to feature; MODIFIER | silent_mutation | Average:31.194; most accessible tissue: Callus, score: 59.223 | N | N | N | N |
| vg0726230011 | C -> T | LOC_Os07g43860-LOC_Os07g43870 | intergenic_region ; MODIFIER | silent_mutation | Average:31.194; most accessible tissue: Callus, score: 59.223 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726230011 | NA | 4.06E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 1.28E-14 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 1.32E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 7.12E-09 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 1.20E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 3.03E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 6.11E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 4.69E-21 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 2.08E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726230011 | NA | 7.28E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/