Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726230011:

Variant ID: vg0726230011 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26230011
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTGTTCTCATGACCGTAACGCATCGTCGCCTACTATTCGTTTTTTTCGTCTCCTTTTTTTTTGATTCGTTTTGTCGTGTTTTTTTGCTGTTTTTATC[C/T]
GGTTTCTTTTTCTTCATTGTTTGTTTTTTCCCGATTCGGTTTTTTTGCTAGGTCTCTTTTTCGCTTTTTTCACCCGGTTTTTTATCTCATCCGATCTGTT

Reverse complement sequence

AACAGATCGGATGAGATAAAAAACCGGGTGAAAAAAGCGAAAAAGAGACCTAGCAAAAAAACCGAATCGGGAAAAAACAAACAATGAAGAAAAAGAAACC[G/A]
GATAAAAACAGCAAAAAAACACGACAAAACGAATCAAAAAAAAAGGAGACGAAAAAAACGAATAGTAGGCGACGATGCGTTACGGTCATGAGAACAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.60%	41.20%	1.82%	0.40%	NA
All Indica	2759	90.20%	6.10%	3.04%	0.65%	NA
All Japonica	1512	1.30%	98.60%	0.00%	0.07%	NA
Aus	269	48.70%	51.30%	0.00%	0.00%	NA
Indica I	595	85.90%	10.30%	3.03%	0.84%	NA
Indica II	465	94.00%	4.10%	1.72%	0.22%	NA
Indica III	913	93.60%	1.30%	4.27%	0.77%	NA
Indica Intermediate	786	87.30%	9.70%	2.42%	0.64%	NA
Temperate Japonica	767	1.20%	98.70%	0.00%	0.13%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	34.40%	63.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726230011	C -> DEL	N	N	silent_mutation	Average:31.194; most accessible tissue: Callus, score: 59.223	N	N	N	N
vg0726230011	C -> T	LOC_Os07g43850.1	upstream_gene_variant ; 4588.0bp to feature; MODIFIER	silent_mutation	Average:31.194; most accessible tissue: Callus, score: 59.223	N	N	N	N
vg0726230011	C -> T	LOC_Os07g43870.1	upstream_gene_variant ; 660.0bp to feature; MODIFIER	silent_mutation	Average:31.194; most accessible tissue: Callus, score: 59.223	N	N	N	N
vg0726230011	C -> T	LOC_Os07g43870.2	upstream_gene_variant ; 668.0bp to feature; MODIFIER	silent_mutation	Average:31.194; most accessible tissue: Callus, score: 59.223	N	N	N	N
vg0726230011	C -> T	LOC_Os07g43870.3	upstream_gene_variant ; 668.0bp to feature; MODIFIER	silent_mutation	Average:31.194; most accessible tissue: Callus, score: 59.223	N	N	N	N
vg0726230011	C -> T	LOC_Os07g43860.1	downstream_gene_variant ; 3470.0bp to feature; MODIFIER	silent_mutation	Average:31.194; most accessible tissue: Callus, score: 59.223	N	N	N	N
vg0726230011	C -> T	LOC_Os07g43860-LOC_Os07g43870	intergenic_region ; MODIFIER	silent_mutation	Average:31.194; most accessible tissue: Callus, score: 59.223	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726230011	NA	4.06E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.28E-14	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.32E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	7.12E-09	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.20E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	3.03E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	6.11E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	4.69E-21	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	2.08E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	7.28E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.24E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.50E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.05E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	9.37E-16	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.74E-15	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.64E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	5.59E-12	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	4.50E-06	NA	mr1667_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	8.79E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	8.70E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	4.16E-10	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	4.34E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	1.70E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726230011	NA	2.74E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251