\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726219340:

Variant ID: vg0726219340 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26219340
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAAATTATATAAATAGATTTATCTTGAAAAATACTTTCATAAAAGTATACATATACACTTTTCAATAAATATTTTTGTAGAAACAATAAGTTAAAGTT[A/G]
TGTTTTGGTGACCGTATCGCTGTCCTAAACGACTTCCTTTATAATTATGGAGAGAGTATATAAAACCAGCAGCCCGGCCTTCGAACCAATCAAAATAACA

Reverse complement sequence

TGTTATTTTGATTGGTTCGAAGGCCGGGCTGCTGGTTTTATATACTCTCTCCATAATTATAAAGGAAGTCGTTTAGGACAGCGATACGGTCACCAAAACA[T/C]
AACTTTAACTTATTGTTTCTACAAAAATATTTATTGAAAAGTGTATATGTATACTTTTATGAAAGTATTTTTCAAGATAAATCTATTTATATAATTTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 13.70% 1.59% 0.00% NA
All Indica  2759 99.20% 0.70% 0.04% 0.00% NA
All Japonica  1512 54.90% 40.30% 4.83% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 24.80% 69.20% 6.00% 0.00% NA
Tropical Japonica  504 93.80% 3.00% 3.17% 0.00% NA
Japonica Intermediate  241 69.30% 26.10% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726219340 A -> G LOC_Os07g43830.1 upstream_gene_variant ; 395.0bp to feature; MODIFIER silent_mutation Average:41.09; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0726219340 A -> G LOC_Os07g43820.1 downstream_gene_variant ; 3082.0bp to feature; MODIFIER silent_mutation Average:41.09; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0726219340 A -> G LOC_Os07g43840.1 downstream_gene_variant ; 913.0bp to feature; MODIFIER silent_mutation Average:41.09; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0726219340 A -> G LOC_Os07g43850.1 downstream_gene_variant ; 4803.0bp to feature; MODIFIER silent_mutation Average:41.09; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0726219340 A -> G LOC_Os07g43830-LOC_Os07g43840 intergenic_region ; MODIFIER silent_mutation Average:41.09; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726219340 NA 2.87E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0726219340 NA 8.08E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 2.78E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 5.23E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 2.52E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 5.16E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 8.77E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 2.94E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 1.18E-06 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 5.14E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 1.98E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 1.87E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 5.97E-08 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 9.59E-07 2.12E-41 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 7.93E-15 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 1.40E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 4.99E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 4.93E-11 mr1180_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 1.18E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 2.48E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 8.47E-07 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 7.17E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 4.51E-29 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 1.45E-10 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 1.81E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 5.73E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726219340 NA 3.45E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251