Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0726218255:

Variant ID: vg0726218255 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26218255
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

TCACGTTTCAACAGCACTTTGGTTTGTGCATGGTTGTGAAAAGAAGGCTTTATATACACTTATATCATTATATGAACTTCATTGACGAAAGAAAGAGTTC[A/G]
ATGTGATTTATAATATAAAACGGATGTAATACTATTTATTTAATCTGAAAAAAAAAGAGAGAGAAAAATTTGTATGAACACCGAGAGTCTTACCGGGACA

Reverse complement sequence

TGTCCCGGTAAGACTCTCGGTGTTCATACAAATTTTTCTCTCTCTTTTTTTTTCAGATTAAATAAATAGTATTACATCCGTTTTATATTATAAATCACAT[T/C]
GAACTCTTTCTTTCGTCAATGAAGTTCATATAATGATATAAGTGTATATAAAGCCTTCTTTTCACAACCATGCACAAACCAAAGTGCTGTTGAAACGTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.30%	17.20%	1.52%	0.00%	NA
All Indica	2759	98.90%	1.00%	0.14%	0.00%	NA
All Japonica	1512	51.90%	43.70%	4.37%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.30%	0.25%	0.00%	NA
Temperate Japonica	767	86.80%	9.10%	4.04%	0.00%	NA
Tropical Japonica	504	6.00%	90.50%	3.57%	0.00%	NA
Japonica Intermediate	241	36.90%	56.00%	7.05%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	61.10%	36.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726218255	A -> G	LOC_Os07g43810.1	downstream_gene_variant ; 4232.0bp to feature; MODIFIER	silent_mutation	Average:59.38; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0726218255	A -> G	LOC_Os07g43820.1	downstream_gene_variant ; 1997.0bp to feature; MODIFIER	silent_mutation	Average:59.38; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0726218255	A -> G	LOC_Os07g43840.1	downstream_gene_variant ; 1998.0bp to feature; MODIFIER	silent_mutation	Average:59.38; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N
vg0726218255	A -> G	LOC_Os07g43830.1	intron_variant ; MODIFIER	silent_mutation	Average:59.38; most accessible tissue: Zhenshan97 flower, score: 80.006	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726218255	NA	2.38E-12	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	1.07E-07	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	5.75E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	8.39E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	1.61E-08	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	1.27E-08	mr1383_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	3.13E-15	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	1.85E-10	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	9.04E-10	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	2.37E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726218255	NA	2.74E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251