| Variant ID: vg0726218255 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26218255 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
TCACGTTTCAACAGCACTTTGGTTTGTGCATGGTTGTGAAAAGAAGGCTTTATATACACTTATATCATTATATGAACTTCATTGACGAAAGAAAGAGTTC[A/G]
ATGTGATTTATAATATAAAACGGATGTAATACTATTTATTTAATCTGAAAAAAAAAGAGAGAGAAAAATTTGTATGAACACCGAGAGTCTTACCGGGACA
TGTCCCGGTAAGACTCTCGGTGTTCATACAAATTTTTCTCTCTCTTTTTTTTTCAGATTAAATAAATAGTATTACATCCGTTTTATATTATAAATCACAT[T/C]
GAACTCTTTCTTTCGTCAATGAAGTTCATATAATGATATAAGTGTATATAAAGCCTTCTTTTCACAACCATGCACAAACCAAAGTGCTGTTGAAACGTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.30% | 17.20% | 1.52% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 51.90% | 43.70% | 4.37% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 86.80% | 9.10% | 4.04% | 0.00% | NA |
| Tropical Japonica | 504 | 6.00% | 90.50% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.90% | 56.00% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 36.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726218255 | A -> G | LOC_Os07g43810.1 | downstream_gene_variant ; 4232.0bp to feature; MODIFIER | silent_mutation | Average:59.38; most accessible tissue: Zhenshan97 flower, score: 80.006 | N | N | N | N |
| vg0726218255 | A -> G | LOC_Os07g43820.1 | downstream_gene_variant ; 1997.0bp to feature; MODIFIER | silent_mutation | Average:59.38; most accessible tissue: Zhenshan97 flower, score: 80.006 | N | N | N | N |
| vg0726218255 | A -> G | LOC_Os07g43840.1 | downstream_gene_variant ; 1998.0bp to feature; MODIFIER | silent_mutation | Average:59.38; most accessible tissue: Zhenshan97 flower, score: 80.006 | N | N | N | N |
| vg0726218255 | A -> G | LOC_Os07g43830.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.38; most accessible tissue: Zhenshan97 flower, score: 80.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726218255 | NA | 2.38E-12 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 1.07E-07 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 5.75E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 8.39E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 1.61E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 1.27E-08 | mr1383_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 3.13E-15 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 1.85E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 9.04E-10 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 2.37E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726218255 | NA | 2.74E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |