\
| Variant ID: vg0726205357 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 26205357 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 122. )
TTGGCCGGGTGCCAACCTTGAATCAATTCAAAGATTGATACATTGCACATACTCCGACCGGACAAGACGCACTACCTCATCCGTGTCGTTTGAGAAGCAC[T/C]
CACTTAGTTGTTTCAAAAAGGAATTTAAATAAAATCAATTGCAAAAACAACAGCCTTTCCTTTGAAGCCTGCATTAAACACTTAATTCCTATAGCTTGCT
AGCAAGCTATAGGAATTAAGTGTTTAATGCAGGCTTCAAAGGAAAGGCTGTTGTTTTTGCAATTGATTTTATTTAAATTCCTTTTTGAAACAACTAAGTG[A/G]
GTGCTTCTCAAACGACACGGATGAGGTAGTGCGTCTTGTCCGGTCGGAGTATGTGCAATGTATCAATCTTTGAATTGATTCAAGGTTGGCACCCGGCCAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 10.50% | 0.28% | 0.06% | NA |
| All Indica | 2759 | 85.80% | 13.60% | 0.47% | 0.11% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.50% | 43.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.40% | 0.00% | 0.17% | NA |
| Indica II | 465 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.10% | 22.90% | 0.88% | 0.11% | NA |
| Indica Intermediate | 786 | 84.40% | 14.90% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0726205357 | T -> DEL | N | N | silent_mutation | Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0726205357 | T -> C | LOC_Os07g43790.1 | upstream_gene_variant ; 934.0bp to feature; MODIFIER | silent_mutation | Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0726205357 | T -> C | LOC_Os07g43800.1 | upstream_gene_variant ; 3172.0bp to feature; MODIFIER | silent_mutation | Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0726205357 | T -> C | LOC_Os07g43790-LOC_Os07g43800 | intergenic_region ; MODIFIER | silent_mutation | Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0726205357 | NA | 6.81E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | NA | 8.07E-06 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | NA | 4.60E-07 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | NA | 1.19E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | NA | 8.96E-08 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | NA | 2.92E-07 | mr1244_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | 4.71E-06 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | 8.06E-07 | 1.07E-06 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | 5.00E-06 | NA | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0726205357 | NA | 6.23E-06 | mr1676_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |