\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726205357:

Variant ID: vg0726205357 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 26205357
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGCCGGGTGCCAACCTTGAATCAATTCAAAGATTGATACATTGCACATACTCCGACCGGACAAGACGCACTACCTCATCCGTGTCGTTTGAGAAGCAC[T/C]
CACTTAGTTGTTTCAAAAAGGAATTTAAATAAAATCAATTGCAAAAACAACAGCCTTTCCTTTGAAGCCTGCATTAAACACTTAATTCCTATAGCTTGCT

Reverse complement sequence

AGCAAGCTATAGGAATTAAGTGTTTAATGCAGGCTTCAAAGGAAAGGCTGTTGTTTTTGCAATTGATTTTATTTAAATTCCTTTTTGAAACAACTAAGTG[A/G]
GTGCTTCTCAAACGACACGGATGAGGTAGTGCGTCTTGTCCGGTCGGAGTATGTGCAATGTATCAATCTTTGAATTGATTCAAGGTTGGCACCCGGCCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 10.50% 0.28% 0.06% NA
All Indica  2759 85.80% 13.60% 0.47% 0.11% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 56.50% 43.50% 0.00% 0.00% NA
Indica I  595 96.50% 3.40% 0.00% 0.17% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 76.10% 22.90% 0.88% 0.11% NA
Indica Intermediate  786 84.40% 14.90% 0.64% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726205357 T -> DEL N N silent_mutation Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0726205357 T -> C LOC_Os07g43790.1 upstream_gene_variant ; 934.0bp to feature; MODIFIER silent_mutation Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0726205357 T -> C LOC_Os07g43800.1 upstream_gene_variant ; 3172.0bp to feature; MODIFIER silent_mutation Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N
vg0726205357 T -> C LOC_Os07g43790-LOC_Os07g43800 intergenic_region ; MODIFIER silent_mutation Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726205357 NA 6.81E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 NA 8.07E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 NA 4.60E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 NA 1.19E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 NA 8.96E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 NA 2.92E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 4.71E-06 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 8.06E-07 1.07E-06 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 5.00E-06 NA mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357 NA 6.23E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251