Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0726205357:

Variant ID: vg0726205357 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 26205357
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGCCGGGTGCCAACCTTGAATCAATTCAAAGATTGATACATTGCACATACTCCGACCGGACAAGACGCACTACCTCATCCGTGTCGTTTGAGAAGCAC[T/C]
CACTTAGTTGTTTCAAAAAGGAATTTAAATAAAATCAATTGCAAAAACAACAGCCTTTCCTTTGAAGCCTGCATTAAACACTTAATTCCTATAGCTTGCT

Reverse complement sequence

AGCAAGCTATAGGAATTAAGTGTTTAATGCAGGCTTCAAAGGAAAGGCTGTTGTTTTTGCAATTGATTTTATTTAAATTCCTTTTTGAAACAACTAAGTG[A/G]
GTGCTTCTCAAACGACACGGATGAGGTAGTGCGTCTTGTCCGGTCGGAGTATGTGCAATGTATCAATCTTTGAATTGATTCAAGGTTGGCACCCGGCCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.20%	10.50%	0.28%	0.06%	NA
All Indica	2759	85.80%	13.60%	0.47%	0.11%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	56.50%	43.50%	0.00%	0.00%	NA
Indica I	595	96.50%	3.40%	0.00%	0.17%	NA
Indica II	465	93.50%	6.50%	0.00%	0.00%	NA
Indica III	913	76.10%	22.90%	0.88%	0.11%	NA
Indica Intermediate	786	84.40%	14.90%	0.64%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0726205357	T -> DEL	N	N	silent_mutation	Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0726205357	T -> C	LOC_Os07g43790.1	upstream_gene_variant ; 934.0bp to feature; MODIFIER	silent_mutation	Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0726205357	T -> C	LOC_Os07g43800.1	upstream_gene_variant ; 3172.0bp to feature; MODIFIER	silent_mutation	Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N
vg0726205357	T -> C	LOC_Os07g43790-LOC_Os07g43800	intergenic_region ; MODIFIER	silent_mutation	Average:43.056; most accessible tissue: Minghui63 flag leaf, score: 61.847	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0726205357	NA	6.81E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	NA	8.07E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	NA	4.60E-07	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	NA	1.19E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	NA	8.96E-08	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	NA	2.92E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	4.71E-06	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	8.06E-07	1.07E-06	mr1486_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	5.00E-06	NA	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726205357	NA	6.23E-06	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251