\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0726187838:

Variant ID: vg0726187838 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 26187838
Reference Allele: TAlternative Allele: A,TA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTCTGTTTCACAAATCTAGACATATATTCTAGATTCATTAGCATCTAAATGAAAATGTGCAATGTTAGAAAGGTGGAACGGAGGAAGTATATTTTT[T/A,TA]
AAAAAATATTTGTGTTGATTCGTAGTAATTTTGAGATAGAGATAGTACTATCCAGAATTATAGTACTTGGGATATGTTTCATCTAGCCAGACATCCAGCC

Reverse complement sequence

GGCTGGATGTCTGGCTAGATGAAACATATCCCAAGTACTATAATTCTGGATAGTACTATCTCTATCTCAAAATTACTACGAATCAACACAAATATTTTTT[A/T,TA]
AAAAATATACTTCCTCCGTTCCACCTTTCTAACATTGCACATTTTCATTTAGATGCTAATGAATCTAGAATATATGTCTAGATTTGTGAAACAGAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 43.30% 0.13% 0.00% TA: 0.11%
All Indica  2759 92.80% 7.10% 0.11% 0.00% TA: 0.04%
All Japonica  1512 1.30% 98.30% 0.20% 0.00% TA: 0.20%
Aus  269 21.90% 77.70% 0.00% 0.00% TA: 0.37%
Indica I  595 95.00% 4.70% 0.34% 0.00% NA
Indica II  465 94.20% 5.80% 0.00% 0.00% NA
Indica III  913 92.60% 7.30% 0.11% 0.00% NA
Indica Intermediate  786 90.60% 9.30% 0.00% 0.00% TA: 0.13%
Temperate Japonica  767 1.20% 98.60% 0.26% 0.00% NA
Tropical Japonica  504 1.60% 97.80% 0.20% 0.00% TA: 0.40%
Japonica Intermediate  241 1.20% 98.30% 0.00% 0.00% TA: 0.41%
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 27.80% 72.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0726187838 T -> TA LOC_Os07g43760.1 upstream_gene_variant ; 2129.0bp to feature; MODIFIER silent_mutation Average:50.224; most accessible tissue: Callus, score: 73.43 N N N N
vg0726187838 T -> TA LOC_Os07g43770.2 downstream_gene_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:50.224; most accessible tissue: Callus, score: 73.43 N N N N
vg0726187838 T -> TA LOC_Os07g43770.3 downstream_gene_variant ; 1404.0bp to feature; MODIFIER silent_mutation Average:50.224; most accessible tissue: Callus, score: 73.43 N N N N
vg0726187838 T -> TA LOC_Os07g43760-LOC_Os07g43770 intergenic_region ; MODIFIER silent_mutation Average:50.224; most accessible tissue: Callus, score: 73.43 N N N N
vg0726187838 T -> A LOC_Os07g43760.1 upstream_gene_variant ; 2128.0bp to feature; MODIFIER silent_mutation Average:50.224; most accessible tissue: Callus, score: 73.43 N N N N
vg0726187838 T -> A LOC_Os07g43770.2 downstream_gene_variant ; 290.0bp to feature; MODIFIER silent_mutation Average:50.224; most accessible tissue: Callus, score: 73.43 N N N N
vg0726187838 T -> A LOC_Os07g43770.3 downstream_gene_variant ; 1405.0bp to feature; MODIFIER silent_mutation Average:50.224; most accessible tissue: Callus, score: 73.43 N N N N
vg0726187838 T -> A LOC_Os07g43760-LOC_Os07g43770 intergenic_region ; MODIFIER silent_mutation Average:50.224; most accessible tissue: Callus, score: 73.43 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0726187838 NA 2.26E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 1.99E-63 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 2.81E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 1.33E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 1.08E-10 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 3.96E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 5.91E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 6.51E-15 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 1.11E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 8.83E-14 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 5.71E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 5.34E-09 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 5.07E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 9.84E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 2.36E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 7.08E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 1.31E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 8.81E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 4.63E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 4.33E-07 NA mr1304_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 2.41E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 6.35E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 5.39E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 4.47E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 2.12E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 1.89E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 1.18E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 1.71E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 6.18E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0726187838 NA 7.36E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251